ID: 947090499

View in Genome Browser
Species Human (GRCh38)
Location 2:226505529-226505551
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947090497_947090499 1 Left 947090497 2:226505505-226505527 CCAATTTAAAAACATCAGTGTAA No data
Right 947090499 2:226505529-226505551 TTTTCATATGAACAGGTTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type