ID: 947093656

View in Genome Browser
Species Human (GRCh38)
Location 2:226542178-226542200
Sequence TAGCATAGTGCAGCTTGTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947093652_947093656 19 Left 947093652 2:226542136-226542158 CCCTAAACATCAACACGGAGTGA No data
Right 947093656 2:226542178-226542200 TAGCATAGTGCAGCTTGTCAGGG No data
947093653_947093656 18 Left 947093653 2:226542137-226542159 CCTAAACATCAACACGGAGTGAG No data
Right 947093656 2:226542178-226542200 TAGCATAGTGCAGCTTGTCAGGG No data
947093650_947093656 26 Left 947093650 2:226542129-226542151 CCTACATCCCTAAACATCAACAC No data
Right 947093656 2:226542178-226542200 TAGCATAGTGCAGCTTGTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947093656 Original CRISPR TAGCATAGTGCAGCTTGTCA GGG Intergenic
No off target data available for this crispr