ID: 947098241

View in Genome Browser
Species Human (GRCh38)
Location 2:226591354-226591376
Sequence GCCTTGGTTTTCCCTATACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947098231_947098241 30 Left 947098231 2:226591301-226591323 CCTCTACTGTAGGACTGCTGCAG No data
Right 947098241 2:226591354-226591376 GCCTTGGTTTTCCCTATACCTGG No data
947098238_947098241 -10 Left 947098238 2:226591341-226591363 CCAGACCCTAGTTGCCTTGGTTT No data
Right 947098241 2:226591354-226591376 GCCTTGGTTTTCCCTATACCTGG No data
947098236_947098241 -5 Left 947098236 2:226591336-226591358 CCACACCAGACCCTAGTTGCCTT No data
Right 947098241 2:226591354-226591376 GCCTTGGTTTTCCCTATACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947098241 Original CRISPR GCCTTGGTTTTCCCTATACC TGG Intergenic
No off target data available for this crispr