ID: 947098357

View in Genome Browser
Species Human (GRCh38)
Location 2:226592076-226592098
Sequence TCCAGCTGGCCAGCAGCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947098357_947098367 22 Left 947098357 2:226592076-226592098 CCTGCTGCTGCTGGCCAGCTGGA No data
Right 947098367 2:226592121-226592143 CCCATGAGGCTTGGAAATTGGGG No data
947098357_947098363 13 Left 947098357 2:226592076-226592098 CCTGCTGCTGCTGGCCAGCTGGA No data
Right 947098363 2:226592112-226592134 GGGTCTCAACCCATGAGGCTTGG No data
947098357_947098362 8 Left 947098357 2:226592076-226592098 CCTGCTGCTGCTGGCCAGCTGGA No data
Right 947098362 2:226592107-226592129 CCAGTGGGTCTCAACCCATGAGG No data
947098357_947098360 -7 Left 947098357 2:226592076-226592098 CCTGCTGCTGCTGGCCAGCTGGA No data
Right 947098360 2:226592092-226592114 AGCTGGAATTTCAAGCCAGTGGG No data
947098357_947098359 -8 Left 947098357 2:226592076-226592098 CCTGCTGCTGCTGGCCAGCTGGA No data
Right 947098359 2:226592091-226592113 CAGCTGGAATTTCAAGCCAGTGG No data
947098357_947098365 21 Left 947098357 2:226592076-226592098 CCTGCTGCTGCTGGCCAGCTGGA No data
Right 947098365 2:226592120-226592142 ACCCATGAGGCTTGGAAATTGGG No data
947098357_947098364 20 Left 947098357 2:226592076-226592098 CCTGCTGCTGCTGGCCAGCTGGA No data
Right 947098364 2:226592119-226592141 AACCCATGAGGCTTGGAAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947098357 Original CRISPR TCCAGCTGGCCAGCAGCAGC AGG (reversed) Intergenic
No off target data available for this crispr