ID: 947098360

View in Genome Browser
Species Human (GRCh38)
Location 2:226592092-226592114
Sequence AGCTGGAATTTCAAGCCAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947098351_947098360 30 Left 947098351 2:226592039-226592061 CCTCCGGGAATTCAGTTCTGACT No data
Right 947098360 2:226592092-226592114 AGCTGGAATTTCAAGCCAGTGGG No data
947098355_947098360 -3 Left 947098355 2:226592072-226592094 CCAGCCTGCTGCTGCTGGCCAGC No data
Right 947098360 2:226592092-226592114 AGCTGGAATTTCAAGCCAGTGGG No data
947098357_947098360 -7 Left 947098357 2:226592076-226592098 CCTGCTGCTGCTGGCCAGCTGGA No data
Right 947098360 2:226592092-226592114 AGCTGGAATTTCAAGCCAGTGGG No data
947098352_947098360 27 Left 947098352 2:226592042-226592064 CCGGGAATTCAGTTCTGACTCAG No data
Right 947098360 2:226592092-226592114 AGCTGGAATTTCAAGCCAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947098360 Original CRISPR AGCTGGAATTTCAAGCCAGT GGG Intergenic
No off target data available for this crispr