ID: 947098362

View in Genome Browser
Species Human (GRCh38)
Location 2:226592107-226592129
Sequence CCAGTGGGTCTCAACCCATG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947098357_947098362 8 Left 947098357 2:226592076-226592098 CCTGCTGCTGCTGGCCAGCTGGA No data
Right 947098362 2:226592107-226592129 CCAGTGGGTCTCAACCCATGAGG No data
947098358_947098362 -6 Left 947098358 2:226592090-226592112 CCAGCTGGAATTTCAAGCCAGTG No data
Right 947098362 2:226592107-226592129 CCAGTGGGTCTCAACCCATGAGG No data
947098355_947098362 12 Left 947098355 2:226592072-226592094 CCAGCCTGCTGCTGCTGGCCAGC No data
Right 947098362 2:226592107-226592129 CCAGTGGGTCTCAACCCATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947098362 Original CRISPR CCAGTGGGTCTCAACCCATG AGG Intergenic
No off target data available for this crispr