ID: 947098363

View in Genome Browser
Species Human (GRCh38)
Location 2:226592112-226592134
Sequence GGGTCTCAACCCATGAGGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947098357_947098363 13 Left 947098357 2:226592076-226592098 CCTGCTGCTGCTGGCCAGCTGGA No data
Right 947098363 2:226592112-226592134 GGGTCTCAACCCATGAGGCTTGG No data
947098358_947098363 -1 Left 947098358 2:226592090-226592112 CCAGCTGGAATTTCAAGCCAGTG No data
Right 947098363 2:226592112-226592134 GGGTCTCAACCCATGAGGCTTGG No data
947098355_947098363 17 Left 947098355 2:226592072-226592094 CCAGCCTGCTGCTGCTGGCCAGC No data
Right 947098363 2:226592112-226592134 GGGTCTCAACCCATGAGGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947098363 Original CRISPR GGGTCTCAACCCATGAGGCT TGG Intergenic
No off target data available for this crispr