ID: 947098364

View in Genome Browser
Species Human (GRCh38)
Location 2:226592119-226592141
Sequence AACCCATGAGGCTTGGAAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947098355_947098364 24 Left 947098355 2:226592072-226592094 CCAGCCTGCTGCTGCTGGCCAGC No data
Right 947098364 2:226592119-226592141 AACCCATGAGGCTTGGAAATTGG No data
947098358_947098364 6 Left 947098358 2:226592090-226592112 CCAGCTGGAATTTCAAGCCAGTG No data
Right 947098364 2:226592119-226592141 AACCCATGAGGCTTGGAAATTGG No data
947098357_947098364 20 Left 947098357 2:226592076-226592098 CCTGCTGCTGCTGGCCAGCTGGA No data
Right 947098364 2:226592119-226592141 AACCCATGAGGCTTGGAAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947098364 Original CRISPR AACCCATGAGGCTTGGAAAT TGG Intergenic
No off target data available for this crispr