ID: 947098367

View in Genome Browser
Species Human (GRCh38)
Location 2:226592121-226592143
Sequence CCCATGAGGCTTGGAAATTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947098357_947098367 22 Left 947098357 2:226592076-226592098 CCTGCTGCTGCTGGCCAGCTGGA No data
Right 947098367 2:226592121-226592143 CCCATGAGGCTTGGAAATTGGGG No data
947098358_947098367 8 Left 947098358 2:226592090-226592112 CCAGCTGGAATTTCAAGCCAGTG No data
Right 947098367 2:226592121-226592143 CCCATGAGGCTTGGAAATTGGGG No data
947098361_947098367 -9 Left 947098361 2:226592107-226592129 CCAGTGGGTCTCAACCCATGAGG No data
Right 947098367 2:226592121-226592143 CCCATGAGGCTTGGAAATTGGGG No data
947098355_947098367 26 Left 947098355 2:226592072-226592094 CCAGCCTGCTGCTGCTGGCCAGC No data
Right 947098367 2:226592121-226592143 CCCATGAGGCTTGGAAATTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947098367 Original CRISPR CCCATGAGGCTTGGAAATTG GGG Intergenic
No off target data available for this crispr