ID: 947100689 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:226618166-226618188 |
| Sequence | CTGTGCTTGTGTGAGTGTGC TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 947100689_947100694 | 13 | Left | 947100689 | 2:226618166-226618188 | CCAGCACACTCACACAAGCACAG | No data | ||
| Right | 947100694 | 2:226618202-226618224 | CATTTGAGAAACAGAGAGCATGG | No data | ||||
| 947100689_947100695 | 24 | Left | 947100689 | 2:226618166-226618188 | CCAGCACACTCACACAAGCACAG | No data | ||
| Right | 947100695 | 2:226618213-226618235 | CAGAGAGCATGGCCCCACTCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 947100689 | Original CRISPR | CTGTGCTTGTGTGAGTGTGC TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||