ID: 947100689

View in Genome Browser
Species Human (GRCh38)
Location 2:226618166-226618188
Sequence CTGTGCTTGTGTGAGTGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947100689_947100694 13 Left 947100689 2:226618166-226618188 CCAGCACACTCACACAAGCACAG No data
Right 947100694 2:226618202-226618224 CATTTGAGAAACAGAGAGCATGG No data
947100689_947100695 24 Left 947100689 2:226618166-226618188 CCAGCACACTCACACAAGCACAG No data
Right 947100695 2:226618213-226618235 CAGAGAGCATGGCCCCACTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947100689 Original CRISPR CTGTGCTTGTGTGAGTGTGC TGG (reversed) Intergenic
No off target data available for this crispr