ID: 947107579

View in Genome Browser
Species Human (GRCh38)
Location 2:226683647-226683669
Sequence TACTTAGTCTTTTCTACTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947107579_947107581 25 Left 947107579 2:226683647-226683669 CCTGGAGTAGAAAAGACTAAGTA No data
Right 947107581 2:226683695-226683717 TAATTTCTCATTGTCCAACTGGG No data
947107579_947107580 24 Left 947107579 2:226683647-226683669 CCTGGAGTAGAAAAGACTAAGTA No data
Right 947107580 2:226683694-226683716 ATAATTTCTCATTGTCCAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947107579 Original CRISPR TACTTAGTCTTTTCTACTCC AGG (reversed) Intergenic
No off target data available for this crispr