ID: 947109121

View in Genome Browser
Species Human (GRCh38)
Location 2:226699553-226699575
Sequence GGGTCCAGTTGTTGTCTTAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947109112_947109121 29 Left 947109112 2:226699501-226699523 CCAGCCAGTCAGGATCCTGCCTG No data
Right 947109121 2:226699553-226699575 GGGTCCAGTTGTTGTCTTAGTGG No data
947109115_947109121 14 Left 947109115 2:226699516-226699538 CCTGCCTGCTAGGACTGTTCTAG No data
Right 947109121 2:226699553-226699575 GGGTCCAGTTGTTGTCTTAGTGG No data
947109113_947109121 25 Left 947109113 2:226699505-226699527 CCAGTCAGGATCCTGCCTGCTAG No data
Right 947109121 2:226699553-226699575 GGGTCCAGTTGTTGTCTTAGTGG No data
947109116_947109121 10 Left 947109116 2:226699520-226699542 CCTGCTAGGACTGTTCTAGTCAG No data
Right 947109121 2:226699553-226699575 GGGTCCAGTTGTTGTCTTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947109121 Original CRISPR GGGTCCAGTTGTTGTCTTAG TGG Intergenic