ID: 947109964

View in Genome Browser
Species Human (GRCh38)
Location 2:226708068-226708090
Sequence TTATATCCACAGAGGGACTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947109964_947109973 16 Left 947109964 2:226708068-226708090 CCCAAGTCCCTCTGTGGATATAA No data
Right 947109973 2:226708107-226708129 AGTAGATGAACTCCTCCTTGGGG No data
947109964_947109972 15 Left 947109964 2:226708068-226708090 CCCAAGTCCCTCTGTGGATATAA No data
Right 947109972 2:226708106-226708128 AAGTAGATGAACTCCTCCTTGGG No data
947109964_947109969 -9 Left 947109964 2:226708068-226708090 CCCAAGTCCCTCTGTGGATATAA No data
Right 947109969 2:226708082-226708104 TGGATATAAATTAGGCCTTCAGG No data
947109964_947109971 14 Left 947109964 2:226708068-226708090 CCCAAGTCCCTCTGTGGATATAA No data
Right 947109971 2:226708105-226708127 AAAGTAGATGAACTCCTCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947109964 Original CRISPR TTATATCCACAGAGGGACTT GGG (reversed) Intergenic
No off target data available for this crispr