ID: 947115121

View in Genome Browser
Species Human (GRCh38)
Location 2:226761688-226761710
Sequence GAGCAGAACTAGAATTTTAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 193}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947115118_947115121 22 Left 947115118 2:226761643-226761665 CCCACAAAGAATCCTAAGTTGTA 0: 1
1: 0
2: 0
3: 11
4: 149
Right 947115121 2:226761688-226761710 GAGCAGAACTAGAATTTTATAGG 0: 1
1: 0
2: 2
3: 19
4: 193
947115120_947115121 10 Left 947115120 2:226761655-226761677 CCTAAGTTGTAGATGATTCAGAT 0: 1
1: 0
2: 2
3: 10
4: 158
Right 947115121 2:226761688-226761710 GAGCAGAACTAGAATTTTATAGG 0: 1
1: 0
2: 2
3: 19
4: 193
947115119_947115121 21 Left 947115119 2:226761644-226761666 CCACAAAGAATCCTAAGTTGTAG 0: 1
1: 0
2: 0
3: 17
4: 140
Right 947115121 2:226761688-226761710 GAGCAGAACTAGAATTTTATAGG 0: 1
1: 0
2: 2
3: 19
4: 193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947115121 Original CRISPR GAGCAGAACTAGAATTTTAT AGG Intronic
907500833 1:54878763-54878785 GAGCAAAACTCAAAATTTATAGG + Intronic
909408401 1:75319069-75319091 CAGCATAGCTAGATTTTTATTGG - Intronic
910094026 1:83499421-83499443 GAACAAAAGTAGAATTTTCTTGG - Intergenic
910273144 1:85418991-85419013 GGGCAGAACCAGTCTTTTATAGG - Intronic
911177477 1:94831681-94831703 GAGTAGAACTAGAATTTACTGGG - Intronic
911411660 1:97516992-97517014 GAGCAGAACTTTAATTTTATAGG + Intronic
913229989 1:116733811-116733833 GAAAAGATTTAGAATTTTATTGG - Intergenic
913432596 1:118811628-118811650 GAGCAGGACTAATATTTTACTGG - Intergenic
916923337 1:169492032-169492054 GAGCTGAACTAGCATTTTACTGG - Intergenic
917695972 1:177524500-177524522 GAGCAGTACCAGCATTTGATGGG - Intergenic
917763805 1:178196079-178196101 GAACAGATGTAGAATGTTATAGG + Intronic
918846008 1:189614162-189614184 ATGCAGAACTGCAATTTTATGGG - Intergenic
918926817 1:190797313-190797335 GAGCAGGAATGGAATTTAATGGG - Intergenic
919463696 1:197908251-197908273 GAGGAAAATTAGAACTTTATTGG - Intergenic
921619433 1:217309712-217309734 GAGAAGAACATGAATTTTAAGGG + Intergenic
921958286 1:221006871-221006893 GAGTAGAAATAGAACATTATTGG - Intergenic
921994295 1:221400382-221400404 GAATAAAACTAGAAATTTATAGG + Intergenic
1063259604 10:4371570-4371592 GGTCAGAACTAGGATTTCATGGG + Intergenic
1064873898 10:19971025-19971047 GAGCAGAACTTGAAGTTTCTAGG - Intronic
1065885732 10:30075273-30075295 GAGGGGAACTAGGATTGTATTGG - Intronic
1067617714 10:47767734-47767756 GATCAACACTGGAATTTTATGGG + Intergenic
1068056452 10:52017591-52017613 GAGCAGAAGTAGAATTTGATGGG + Intronic
1069350554 10:67521256-67521278 GAGCTGAAATAAACTTTTATAGG - Intronic
1070460277 10:76660585-76660607 TAGCAGAAATAGAACTTTAAGGG + Intergenic
1070609695 10:77925310-77925332 GAGGAGAACTAGCATTTATTGGG - Intronic
1071424232 10:85532229-85532251 GAGCAGAAATAGAAACCTATGGG + Intergenic
1071556129 10:86603288-86603310 GTTCATAACTAAAATTTTATTGG + Intergenic
1071741199 10:88360277-88360299 GAGTAGAACTGGACTTGTATAGG + Intronic
1071751704 10:88485930-88485952 GATCAGAATTAATATTTTATTGG - Intronic
1072763456 10:98077545-98077567 GGGCAGAACAAGAAAATTATAGG + Intergenic
1074218420 10:111410728-111410750 GAGCATAACTTGAAGTTGATTGG + Intergenic
1074597037 10:114876957-114876979 GAGCACAACTAGAATTATTCCGG - Intronic
1078562543 11:12385704-12385726 GACCATAACTAAAATTATATGGG - Intronic
1078656121 11:13241451-13241473 CAACAGAAGTAGAAATTTATAGG - Intergenic
1079165761 11:18041315-18041337 AAGCAGAACTAGAATTCTCCTGG - Exonic
1085011992 11:73147798-73147820 GAGCAGAACTAAGATTCTAGTGG - Intergenic
1085328897 11:75630590-75630612 TACCAGATCTTGAATTTTATAGG + Intronic
1088749217 11:112829828-112829850 GATCATAACCAGAATTTTAGGGG - Intergenic
1089995989 11:122908068-122908090 GAGCTGAACTGGAATTTCAGTGG - Intronic
1092069400 12:5620647-5620669 GAGTTGAACTAGAATTCTATAGG + Intronic
1093615913 12:21224334-21224356 GAGTAGAATTACAATTTTATGGG - Intronic
1094323364 12:29209544-29209566 CAGCAGAACTGGAATTTCAAGGG - Intronic
1096900747 12:54878651-54878673 GAGCAGAATTATAATTGTAAGGG + Intergenic
1097607927 12:61778757-61778779 AAGAAGAAATAGAAGTTTATAGG - Intronic
1098194073 12:67981077-67981099 GAGGAGAATCAGAGTTTTATTGG - Intergenic
1100881640 12:99024972-99024994 AACCAAAACTAGAATTTTATTGG - Intronic
1101404357 12:104414892-104414914 TAGCAGAAGTAGGTTTTTATTGG + Intergenic
1102421306 12:112804975-112804997 GAGAAGAACTAGGCATTTATAGG + Intronic
1103461524 12:121108519-121108541 CCGCAGAACTACAGTTTTATTGG + Intergenic
1104327335 12:127811863-127811885 TAGGGGAACTAGAATTTGATTGG + Intergenic
1104600647 12:130151111-130151133 GAGCAGAACTAGGATTTTGGAGG - Intergenic
1105574654 13:21639070-21639092 AAGCAGAACTGAAATTTTAATGG + Intergenic
1105851088 13:24337373-24337395 GAGGAAAACTAAAACTTTATTGG + Intergenic
1110108444 13:71710399-71710421 AATGAGAACTAGAATTTTATGGG + Intronic
1111450053 13:88403520-88403542 AAGGAAAACTAGAATTGTATAGG - Intergenic
1112068629 13:95822419-95822441 TATCAGAACTAGGATTTTTTTGG + Intronic
1112711408 13:102133185-102133207 GTGCAGACCTAGAATTATAATGG - Intronic
1113862677 13:113499714-113499736 GAGGAGAACTCGTATTTTAAGGG + Intronic
1114006658 14:18320929-18320951 GAGGAGAAATACAATTTTAAGGG + Intergenic
1114812300 14:25915429-25915451 GTGCAGAACCAGAAATTAATAGG - Intergenic
1115385028 14:32787620-32787642 TAGCAGCACTAAAATTTTACAGG - Intronic
1115708865 14:36028091-36028113 GATCAGATTTAGATTTTTATAGG - Intergenic
1116525264 14:45896344-45896366 GAGAAGAACAAGAAATTTCTTGG - Intergenic
1116737787 14:48715985-48716007 GAACAGAATTATAATTATATGGG - Intergenic
1117581330 14:57154312-57154334 GAGCAGGACATGAATTTTGTGGG + Intergenic
1119670324 14:76513532-76513554 TGGCAGAGCAAGAATTTTATTGG - Intergenic
1120081369 14:80220447-80220469 GTGGAGAACTAAAATTTAATTGG - Intronic
1120379918 14:83763816-83763838 GAGAAGAAATAGAATATTGTTGG - Intergenic
1120609574 14:86623593-86623615 GAGAAGAACATGAATTTTAGGGG - Intergenic
1121227017 14:92328527-92328549 TAGCAGAAATAGAAATTTAGTGG + Intronic
1125199501 15:37089147-37089169 GCTCAGAAGTAGAACTTTATCGG + Intronic
1125307929 15:38343143-38343165 GAGATGAATTTGAATTTTATTGG - Intronic
1126889559 15:53189857-53189879 GAGGAGAATTAGAATGATATTGG - Intergenic
1128252198 15:66171364-66171386 GAGCAGGACCAGAATCTTAGAGG - Intronic
1128536779 15:68497605-68497627 GAGCAGACATAACATTTTATAGG + Intergenic
1133743652 16:8670960-8670982 GTGCATAAATAAAATTTTATGGG - Intergenic
1134203294 16:12216642-12216664 GGGCAGAGCTAGAACTTTCTCGG - Intronic
1138832016 16:60385815-60385837 GAGACCAACTAAAATTTTATTGG - Intergenic
1139208788 16:65055779-65055801 GATCAGCAGTAGAATGTTATGGG + Intronic
1140611077 16:76599753-76599775 GAGCAGTTCTAGAATTGTCTGGG - Intronic
1140655006 16:77131382-77131404 GAGCAGAACTTGAATTGGAATGG - Intergenic
1145156492 17:20548200-20548222 GAGCATACCTAGTATTTTTTGGG + Intergenic
1146576121 17:33993189-33993211 AAGCAGAAATATAATTTCATTGG + Intronic
1153048999 18:883469-883491 GACCAGAACTAAAACTCTATGGG - Intergenic
1153073245 18:1131469-1131491 GAGGTGAACTAGATTTTCATTGG + Intergenic
1155548834 18:26943360-26943382 GGGTAAAACTAGAACTTTATTGG + Intronic
1156339321 18:36197063-36197085 GAGCAAAACTAGAAGTTAAGAGG + Intronic
1156875094 18:42000635-42000657 GAGAAGAAAAAGAATTTTAATGG + Intronic
1158730675 18:60018945-60018967 GAGCAGAAATTAAATTTTATGGG + Intergenic
1158770469 18:60510818-60510840 GAGCAGATATTGAATTTTTTTGG + Intergenic
1159727467 18:71979821-71979843 GTCCAGAGCTAGAATTTAATTGG + Intergenic
1160064379 18:75561532-75561554 GAGGAGAACTAAAATATGATTGG - Intergenic
1160211166 18:76881184-76881206 GAGTGGAATTAGAATTCTATAGG + Intronic
1163907816 19:20162399-20162421 AAGGAGGACTAGAAATTTATTGG + Intergenic
926344784 2:11935327-11935349 GGGCAAAACTAGAAGTGTATTGG + Intergenic
926458108 2:13093889-13093911 TAGCAAAACTAGATTTTTCTTGG + Intergenic
926638827 2:15213033-15213055 GACCAGAATTAGAGCTTTATAGG + Intronic
928675114 2:33643286-33643308 AAGCAGGACTAGAAATATATAGG - Intergenic
929586247 2:43116607-43116629 GAGAAGAACATGAATTTTATGGG - Intergenic
930979001 2:57498715-57498737 GAGGAAATCTAGAATTTTTTTGG - Intergenic
931168644 2:59778657-59778679 GAACAGATCTAGAATTTTCTAGG + Intergenic
931849451 2:66237685-66237707 GTGCAAAACTAGGATTTTAGTGG + Intergenic
932826249 2:74943487-74943509 GAGCAACAGTAGGATTTTATGGG + Intergenic
933076181 2:77930011-77930033 CAGCAGCATTAGATTTTTATAGG - Intergenic
935219240 2:100998106-100998128 AAGCAGAACAAGATTTTTAATGG + Intergenic
936955201 2:118015648-118015670 GAGTAGAAATTGAAGTTTATTGG - Intergenic
937766657 2:125669108-125669130 GAGCAATACTAGTATTTTTTGGG + Intergenic
938181736 2:129190706-129190728 GAGCTTAAGTAGAACTTTATGGG + Intergenic
938529904 2:132174540-132174562 GAGGAGAAATACAATTTTAAGGG - Intronic
940323409 2:152400516-152400538 GAGCAAAACTTAAATTTTAGGGG + Intronic
940517933 2:154704655-154704677 ATGTAGACCTAGAATTTTATTGG - Intronic
941255479 2:163225611-163225633 GAGGGGAAATAGGATTTTATGGG - Intergenic
942782363 2:179659405-179659427 GAGCATAATAAGAATTTCATTGG - Intronic
945477347 2:210300206-210300228 AAGTAGAAATAGGATTTTATGGG + Intronic
945531450 2:210958677-210958699 CAGCAGAAGTAGCATTGTATAGG + Intergenic
945786449 2:214245114-214245136 ATGCAGAAGTAGAAGTTTATAGG - Intronic
947115121 2:226761688-226761710 GAGCAGAACTAGAATTTTATAGG + Intronic
1169815018 20:9647683-9647705 CAGCACAACTATAATTTTAATGG + Intronic
1170135675 20:13070939-13070961 AAGCAGAATGAGATTTTTATGGG - Intronic
1180431167 22:15251740-15251762 GAGGAGAAATACAATTTTAAGGG + Intergenic
1182820835 22:33214793-33214815 AGGCAGAATTAGAATTTTCTGGG + Intronic
950643667 3:14364407-14364429 TAGCAGAACTAGAATTAGAACGG - Intergenic
952731981 3:36647913-36647935 GAGCAGAACAAGCAATTTACTGG + Intergenic
954338668 3:49936165-49936187 GAGCATGACTAGAATTTTTAAGG - Intergenic
955519086 3:59757281-59757303 GTGCAGAAATAGAATTTGCTTGG - Intronic
957316165 3:78579381-78579403 GAGTAAAAATAGAATTTTAATGG - Intergenic
958136070 3:89493872-89493894 AAAAAGAACTAGAATTTTTTCGG - Intergenic
960160651 3:114347024-114347046 GAGCAGTACAAGATTTTAATTGG + Intronic
962472788 3:135727906-135727928 AAGCAGAGGTTGAATTTTATTGG + Intergenic
966138681 3:176730348-176730370 GAGGAGAAATAGATTTATATTGG - Intergenic
966724407 3:183096561-183096583 GAGCAGGACTAGTATTTCACTGG + Intronic
967344457 3:188438629-188438651 GAACAGGACTAGAATCTCATAGG + Intronic
970090076 4:12396501-12396523 GACCAGAAATAGAATATTAGTGG + Intergenic
971434129 4:26601626-26601648 GAGTAGAACTAGAGTTTTAGAGG + Intronic
972207896 4:36799534-36799556 GATAAGAACTAGAATTCTCTGGG - Intergenic
974251573 4:59392368-59392390 GAGCAGTAATTGAGTTTTATTGG - Intergenic
975243076 4:72085105-72085127 GAGTAAAACTAGAAATGTATGGG + Intronic
976845604 4:89485753-89485775 CAGTAGAACTTGAATTTTAAAGG - Intergenic
977390820 4:96408095-96408117 GAGCAGAAACTGAATTTAATAGG + Intergenic
977787013 4:101047954-101047976 GCACAGAAATAAAATTTTATTGG + Intronic
979294572 4:119016452-119016474 GAGCAGAACTAGAACTATTTGGG - Intronic
980076034 4:128293898-128293920 AAAGAGAACTAAAATTTTATTGG + Intergenic
980077019 4:128304472-128304494 CAGGAGAACCAGACTTTTATAGG + Intergenic
980548307 4:134299187-134299209 CAGCAGACCTAGAATTTGCTTGG + Intergenic
980688909 4:136265549-136265571 GATCAGGTCTAGAATTCTATTGG - Intergenic
981194204 4:141899736-141899758 CAGCTGAAAGAGAATTTTATAGG + Intergenic
981498886 4:145425113-145425135 GAGCAGAGTTTGAATTTTATAGG + Intergenic
982740979 4:159056713-159056735 GTGAAGAACAAGAATTTGATAGG + Intergenic
983884442 4:172964597-172964619 GAGGAGAACTGGAATTATTTAGG - Intronic
984196482 4:176663794-176663816 GACTAGAACCATAATTTTATTGG - Intergenic
988413817 5:30920015-30920037 GAACTAAACAAGAATTTTATCGG + Intergenic
991544615 5:67767637-67767659 CAGAAGAACTTGAATTCTATAGG + Intergenic
993352734 5:86869711-86869733 GAGCAGAGCTTGAGTATTATTGG + Intergenic
994709604 5:103250848-103250870 TAGAAGAACTAGAAATCTATAGG - Intergenic
994891120 5:105638150-105638172 GCCCACAATTAGAATTTTATTGG - Intergenic
994994149 5:107038293-107038315 GAAAACATCTAGAATTTTATTGG - Intergenic
995629226 5:114115325-114115347 GAGCAGTAAAAGCATTTTATAGG - Intergenic
997443332 5:133924299-133924321 GAGCAAAACTAGGAAATTATTGG + Intergenic
998640012 5:143998666-143998688 GATTAGAACTAGAATTTTAAGGG + Intergenic
1000186156 5:158860084-158860106 GTGCGGAACTAGAAGTTTATTGG - Intronic
1001000114 5:167997633-167997655 GGGCATAATTAAAATTTTATGGG - Intronic
1006202889 6:32312466-32312488 TAGCATAACTAGAAAATTATGGG + Intronic
1009662282 6:66630275-66630297 AATCCAAACTAGAATTTTATTGG + Intergenic
1011562734 6:88638703-88638725 AATCAGAGCTAGAATATTATTGG + Intronic
1012166525 6:95961060-95961082 GAGGATAACTATAATTTTGTAGG - Intergenic
1012420034 6:99054808-99054830 CAGCAGAGCCAGAATTTTACTGG - Intergenic
1012583930 6:100899550-100899572 GAGGAGAAATAGAATTTACTAGG - Intergenic
1012593724 6:101015873-101015895 GAGGATAACTACAACTTTATAGG + Intergenic
1019854435 7:3590226-3590248 GAGCAGAAGTTGAATTTTAGTGG + Intronic
1020770974 7:12394190-12394212 TGGCAGAAATAGAATTTTTTAGG - Intronic
1021022073 7:15613433-15613455 TATCAGAACTAGAATATAATTGG + Intronic
1021964919 7:25907848-25907870 CGGCAGAATTAGAATTTTCTTGG - Intergenic
1022569353 7:31436157-31436179 CACCAGTTCTAGAATTTTATAGG - Intergenic
1026237137 7:68536876-68536898 CAAAAGAACTAGAATTTTAGTGG - Intergenic
1026417297 7:70195667-70195689 GAGCAGATTTAGAATTCTTTTGG - Intronic
1029253893 7:99255888-99255910 GAGTCGAACTAGAATTCCATGGG + Intergenic
1031080680 7:117254228-117254250 AAGCTTTACTAGAATTTTATAGG - Intergenic
1031256586 7:119458507-119458529 AAGAAGAATTAGAATTTTAGGGG + Intergenic
1031350463 7:120724242-120724264 GAGTAGAATTAGATTTTTACAGG - Intronic
1036080047 8:5545257-5545279 GATCAAAACTAGAATGTAATAGG - Intergenic
1037290026 8:17340557-17340579 GAGAAAAACTGGAATTTTATTGG + Intronic
1037444970 8:18956312-18956334 GATCAGAACCAGAGTTTTAGCGG - Intronic
1037812174 8:22093453-22093475 GAGCAGAACCAGAATTTTCCAGG + Intronic
1038844087 8:31212820-31212842 GGGCATATATAGAATTTTATTGG - Intergenic
1039222349 8:35347198-35347220 GAGCAGAATTAGATTCTTTTTGG + Intronic
1039505143 8:38046601-38046623 GATAATAACTAGAATTGTATGGG + Intronic
1042168987 8:65974110-65974132 GAGAAGGACTTGAATTTTAGTGG + Intergenic
1042594750 8:70435102-70435124 GAGCAGAAATTGATTTTTAGGGG - Intergenic
1042984854 8:74572070-74572092 AAGCAGAACTACAGTTTTCTTGG - Intergenic
1043140446 8:76582130-76582152 CAGTAGAGCTATAATTTTATGGG - Intergenic
1044120143 8:88384253-88384275 TACCAGAACAAGAATTATATGGG - Intergenic
1044415224 8:91931107-91931129 TAGAAGAACTAGAAATATATGGG - Intergenic
1045091536 8:98750561-98750583 GAGCATAGCTAAAATTTTAAAGG - Intronic
1047426658 8:124752628-124752650 GTGCACATCTAAAATTTTATGGG + Intergenic
1048115319 8:131515348-131515370 GAGAAGAACTGTAGTTTTATGGG - Intergenic
1048523088 8:135175256-135175278 GGGCAGAACTATAAATATATTGG + Intergenic
1051873558 9:21767084-21767106 GAGAAGAACATGAATTTTAAGGG - Intergenic
1052193515 9:25684526-25684548 GAGAAGAACATGAATTTTAGAGG + Intergenic
1052530590 9:29679463-29679485 GAGAAGATGTTGAATTTTATAGG - Intergenic
1052814913 9:33094871-33094893 GAGCAGAAATAGCATTTTGGGGG - Intergenic
1053028031 9:34747486-34747508 GACCAGAACAAGCATTTTACAGG + Intergenic
1056550165 9:87646228-87646250 GAGAAGATCTAAAATTTCATGGG - Intronic
1058720054 9:107755878-107755900 GAGCAAAACTTGAATTTTCCTGG + Intergenic
1059767694 9:117399409-117399431 GAGCAAAATTTGAATTTTAGAGG + Intronic
1062210311 9:135360104-135360126 GAACAGCACTAGAATCTTCTGGG + Intergenic
1192163553 X:68808089-68808111 CTGCAGAACTAGCATTTTCTAGG + Intergenic
1194079476 X:89441390-89441412 GTGCAGAACAAGGTTTTTATAGG - Intergenic
1195508936 X:105691938-105691960 GAGCAGATCTAGAATTAAACAGG + Intronic
1195627531 X:107019499-107019521 GAGAAGAACTTGAGTTTTGTGGG - Intergenic
1195793355 X:108615315-108615337 GATCAGCACTAGAAGTTTCTAGG - Intronic
1198169524 X:134092046-134092068 GAGAAGAAATGGAGTTTTATGGG - Intergenic
1199641108 X:149862749-149862771 TATCAGAACTAGAAGTTTTTGGG - Intergenic
1199790957 X:151154779-151154801 GAACAGAACAAGAAGCTTATGGG - Intergenic
1199823027 X:151469976-151469998 GAGAATAACAAGAATGTTATAGG - Intergenic
1200432094 Y:3096693-3096715 GTGCAGAACAAGGTTTTTATAGG - Intergenic