ID: 947115631

View in Genome Browser
Species Human (GRCh38)
Location 2:226767477-226767499
Sequence ATGGCTAAGGGCCCTTTTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 89}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947115631 Original CRISPR ATGGCTAAGGGCCCTTTTGT TGG (reversed) Intronic
900627494 1:3615670-3615692 GTGGCTCAGGGCCCTCTTGCAGG - Intergenic
900846791 1:5110375-5110397 ATGGAGCAGGGACCTTTTGTTGG + Intergenic
901504954 1:9678958-9678980 ATGTGTAAGGCCCCTTTTGTGGG + Intronic
906639517 1:47433319-47433341 ATGTCTAAGTGCGCTCTTGTGGG - Intergenic
906711538 1:47933986-47934008 ATGGCTAAGGGTTGTTTTATTGG + Intronic
910614324 1:89180391-89180413 TTGACTGAGGGCCCTTTTGCAGG - Intergenic
915449488 1:155994726-155994748 ATGGCACAGGGCCCATTTGTAGG - Intronic
916168653 1:161984664-161984686 ATGGCTAAAGGACCTTTCCTTGG - Intronic
916440398 1:164819282-164819304 ATGGCTAATGGCCCTTCTTGAGG + Intronic
918393341 1:184089368-184089390 ATGGCTAAGGCCCTATTTGTTGG + Intergenic
1068856013 10:61798188-61798210 ATGGCTGTGGGCCCTGCTGTGGG + Intergenic
1074618202 10:115092374-115092396 AAGGAAAACGGCCCTTTTGTGGG + Intergenic
1083538718 11:63495692-63495714 ATGGCTAAGGGCCTGGATGTGGG - Intergenic
1085452974 11:76648029-76648051 CTGGCTGAGGGTCCTTCTGTAGG + Intergenic
1087988013 11:104709060-104709082 CTGGCTATGGGCCTTTTTGTGGG - Intergenic
1088520714 11:110696383-110696405 ATGGCTAAGGACCAGTTTGCTGG - Intronic
1094714589 12:32999979-33000001 ATGGTTGAGGCCTCTTTTGTAGG + Intergenic
1101829941 12:108249241-108249263 ATAGCAAAGGACCCATTTGTAGG - Exonic
1103021437 12:117537942-117537964 ATGGGGAAGGGCCGTTTTATGGG - Intronic
1103687093 12:122740759-122740781 AGGGCTAACTGCTCTTTTGTAGG + Intergenic
1104944793 12:132410764-132410786 ATGGCAAAGGACCTTTTTGGGGG + Intergenic
1104996204 12:132659068-132659090 ATGGATAATTGCCATTTTGTAGG - Intronic
1108576683 13:51797109-51797131 ATGACTGAGGGTCCTTTTGGGGG + Intronic
1111268973 13:85854647-85854669 GTGGCCAAGGGTGCTTTTGTTGG - Intergenic
1120974414 14:90236099-90236121 ATGGGTAAGGGGCTTTTTGGAGG - Intergenic
1124590617 15:31050159-31050181 ATGACTCAGGGCCCCTCTGTGGG + Intronic
1133477554 16:6138167-6138189 ATGACTTAGGGCCCATTTGATGG + Intronic
1136511673 16:30741688-30741710 AAGGCCAAGGGCTCTGTTGTTGG + Intronic
1137427565 16:48392401-48392423 ATGGCTCATGGCCCCTTTCTGGG - Intronic
1138333048 16:56230639-56230661 ATAGCTAAGGGCCCCTTTTCTGG + Intronic
1139380282 16:66526220-66526242 GTGTCTTAGGACCCTTTTGTGGG - Intronic
1142047083 16:87932453-87932475 GTGGCAATGAGCCCTTTTGTTGG - Intronic
1142715137 17:1743092-1743114 CTGGCCAAGGGCTCTTGTGTGGG + Intronic
1148406779 17:47423294-47423316 ATGGTGAAGGGGCATTTTGTTGG + Intronic
1153813088 18:8769183-8769205 ATGCCCAAGGGCCCATCTGTAGG + Intronic
1155739851 18:29275517-29275539 ATGTATAAGAGCTCTTTTGTTGG + Intergenic
1159914025 18:74173120-74173142 ATGGCTTAGAGCCCCTTTCTGGG - Intergenic
926312837 2:11686805-11686827 ATCGATATGGGTCCTTTTGTGGG + Intronic
928825150 2:35411712-35411734 ATGGTCAAGAGCTCTTTTGTAGG - Intergenic
931799626 2:65746308-65746330 ATTGATAAAGGCCTTTTTGTTGG + Intergenic
931881215 2:66573485-66573507 ATTGCTAAGGGCCGGTTTATAGG - Exonic
944778682 2:202995368-202995390 ATGTCTGTTGGCCCTTTTGTTGG - Intronic
945683283 2:212938704-212938726 TTGGCTTAGGGCCCATTTGTAGG - Intergenic
945683370 2:212939446-212939468 TTGGCTTAGGGCTCATTTGTAGG + Intergenic
946638678 2:221758969-221758991 ATGGCTAAGTGCCATTTCCTTGG + Intergenic
947115631 2:226767477-226767499 ATGGCTAAGGGCCCTTTTGTTGG - Intronic
947767036 2:232644412-232644434 GTGGCTAAGGGCACCTCTGTTGG + Intronic
947987268 2:234459693-234459715 ATGGCTTGGTGCCCTCTTGTAGG + Intergenic
1171393023 20:24813617-24813639 ATGGCTGAGGGCTCTTCTGCTGG - Intergenic
1173330503 20:42072245-42072267 TTGGCTAAGGGCTCTATTCTAGG - Intergenic
1179929845 21:44559946-44559968 ATGGCTAAGGGCTCTGTTGGAGG + Intronic
1181061832 22:20285457-20285479 ATGGCTGAGGGCCTGTTTGGGGG + Intergenic
1182677921 22:32054586-32054608 ATGGCCAAAGGCCCTGATGTAGG + Intronic
1183325817 22:37193125-37193147 ATGGCTAATGGCAGTTTTGTGGG - Intronic
1183862617 22:40680742-40680764 ATGGCTCAGGGCACTCTGGTAGG + Intronic
1184333788 22:43841536-43841558 AGGGCTGAGGGGCCATTTGTGGG - Intronic
951839537 3:27019470-27019492 ATCAATAAGGGACCTTTTGTGGG - Intergenic
953957885 3:47245600-47245622 ATGGGTGAGGCCCCTTGTGTGGG + Intronic
954226836 3:49187388-49187410 AGGGCTAAGGGCCCCTGTGGAGG + Intronic
954675485 3:52313191-52313213 ATGGCTGGGGGCCCTGTTGATGG + Intergenic
960088595 3:113616295-113616317 GTGGCTAAAGGCCCATTAGTGGG + Intronic
965691897 3:171366137-171366159 ATGGGTATGTGGCCTTTTGTTGG + Intronic
969211838 4:5693698-5693720 ATGGCCAAGAGCCCTTTTTTGGG - Intronic
975715023 4:77197298-77197320 ATGTCAGAGGGCCCGTTTGTAGG - Intronic
980588202 4:134847698-134847720 ATGGCTAAAGGTCATTTTGGGGG - Intergenic
987231519 5:15898568-15898590 ATGCCTAAGGACAATTTTGTTGG - Intronic
988891655 5:35624104-35624126 CTGGCTAAGGGCCATTTTGATGG + Intronic
989551592 5:42741914-42741936 ATGCCTAAGAGGCCTTGTGTAGG + Intergenic
991432093 5:66559024-66559046 ATAGCTAGGGGACCTTTTCTGGG - Intergenic
991971767 5:72148349-72148371 CTGGGTATGGGCCCTTCTGTGGG - Intronic
992610213 5:78501410-78501432 CTGGCTGAGGGCCCTTCTGCGGG + Intronic
995742745 5:115371956-115371978 ATGGATGAGGGCCCTATGGTTGG + Intergenic
995913241 5:117212940-117212962 CTGACTAAAGGCCCTGTTGTAGG - Intergenic
1001092591 5:168752265-168752287 ATGTCCAAGGGCCCTGTGGTTGG - Intronic
1001491643 5:172160175-172160197 CTGGCTAGGGGCCATTTTGTAGG - Intronic
1004246327 6:13980152-13980174 ATGGGTTAGGTCCCCTTTGTTGG - Exonic
1007967627 6:46016357-46016379 ATGGCAAATGCCCCTTTTGGTGG - Intronic
1010180875 6:73085432-73085454 AAAGCAAAGGGGCCTTTTGTTGG - Intronic
1011294304 6:85809832-85809854 AAGGCTAAAGGCCCTTTTTTTGG + Intergenic
1012727740 6:102837688-102837710 TTGGCTAATGGCCCTAATGTTGG - Intergenic
1013346169 6:109262752-109262774 ATGTCTACAGGGCCTTTTGTGGG - Intergenic
1019542634 7:1558459-1558481 ATGGCTGGGGGCCCGTTTGAAGG + Intronic
1024943551 7:54786080-54786102 ATGGCTAAGGGCAGTTTGGTTGG - Intergenic
1028942544 7:96539477-96539499 ATGGCTCAGTGCCATATTGTAGG - Intronic
1033814253 7:145053115-145053137 ATGGCTAAAAGGCCTTTTGGAGG + Intergenic
1034124909 7:148662758-148662780 ATGTCCAAGGGCCCTGTGGTGGG + Intergenic
1036659853 8:10700917-10700939 ATGGCTCTGGGTCCTCTTGTGGG - Intronic
1037763175 8:21755816-21755838 ATGGCTGAAGGCCCTTGTCTTGG - Intronic
1043699101 8:83261620-83261642 TTGGTTAAAGGCTCTTTTGTTGG - Intergenic
1045800698 8:106097363-106097385 AGGGCCAAGGGCTCTTTAGTTGG - Intergenic
1048967253 8:139624051-139624073 CTGGCTTAGGGCCCTGCTGTTGG - Intronic
1049154893 8:141060389-141060411 CTGGGTCAGGGCCCCTTTGTAGG - Intergenic
1052092802 9:24350072-24350094 ATGGAAAAGGGCCATTTTATGGG - Intergenic
1058526862 9:105867550-105867572 ATGGCTAAGAGTCTTTCTGTGGG + Intergenic
1059811579 9:117861052-117861074 AGGGCTAAGTGACCTTTAGTGGG + Intergenic
1059924488 9:119194645-119194667 ATGGCTAGGGGCCCTTCTCCAGG - Intronic
1060002668 9:119972789-119972811 ATGGCTAAGGGATATTTAGTGGG - Intergenic
1060971320 9:127739793-127739815 AGGGCTCAGGGCCCTCTGGTGGG + Exonic
1061712223 9:132496458-132496480 ATGGCTAAGGGGCGTTCTTTGGG - Intronic
1194844232 X:98783646-98783668 AAGGCAAAGGGCCCTTTTGAAGG + Intergenic
1197883907 X:131197811-131197833 ATGGCTATGGTCCCCTTTGGAGG - Intergenic
1198078553 X:133217244-133217266 ATGGCTCAGGGAACTTTTGGAGG - Exonic
1198397459 X:136234775-136234797 CTGGCTAATGACGCTTTTGTTGG + Intronic