ID: 947118379

View in Genome Browser
Species Human (GRCh38)
Location 2:226795330-226795352
Sequence CGGTAGCAGCAGCAGCAGCG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 783
Summary {0: 1, 1: 1, 2: 20, 3: 140, 4: 621}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947118379_947118387 11 Left 947118379 2:226795330-226795352 CCTCGCTGCTGCTGCTGCTACCG 0: 1
1: 1
2: 20
3: 140
4: 621
Right 947118387 2:226795364-226795386 TACTGCTGCCCCCGCTCCAAAGG 0: 1
1: 0
2: 0
3: 9
4: 99
947118379_947118388 12 Left 947118379 2:226795330-226795352 CCTCGCTGCTGCTGCTGCTACCG 0: 1
1: 1
2: 20
3: 140
4: 621
Right 947118388 2:226795365-226795387 ACTGCTGCCCCCGCTCCAAAGGG 0: 1
1: 0
2: 0
3: 7
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947118379 Original CRISPR CGGTAGCAGCAGCAGCAGCG AGG (reversed) Exonic
900237557 1:1599986-1600008 CAGCAGCAGCAGCAGCGGCGGGG + Exonic
900320172 1:2079640-2079662 CGCCATCAGCAGCAGCCGCGGGG - Intronic
900437409 1:2637800-2637822 TTGTAGCAGCAGCAGCCCCGAGG - Intronic
900652157 1:3735003-3735025 CGGCAGCAGCAGCAGACTCGGGG + Exonic
902072202 1:13749554-13749576 CGGTCGGGCCAGCAGCAGCGAGG - Intronic
902150763 1:14441380-14441402 CAGCAGCAGCAGCAGCACCTGGG + Intergenic
902783922 1:18721025-18721047 CGGGAGCAGCAGCAGCAGGCAGG + Intronic
903115642 1:21176610-21176632 CGGCAGCAGCAGCCGCCCCGCGG + Intronic
903190617 1:21653672-21653694 TAGTAGCAGCAGCAGCAGCAGGG + Intronic
903349849 1:22711005-22711027 CAGCGGCAGCAGCAGCAGCGCGG - Exonic
903510073 1:23868227-23868249 GAGCAGCAGCAGCAACAGCGCGG + Exonic
903586784 1:24421957-24421979 CGGTGGCAGCAGCAGGAGTCAGG - Intronic
904028862 1:27521553-27521575 CATCAGCAGCAGCAGCAGCAGGG - Intergenic
904563622 1:31414191-31414213 CTGTAGCTGCAGCCGCAGAGGGG + Intronic
904773188 1:32892497-32892519 GGGAAGCAGCAGCAGGAGCTGGG + Intronic
904940765 1:34164061-34164083 CGGCAGCGGCAGCGGCGGCGCGG - Intronic
905172090 1:36115367-36115389 CGGCAGCAGCGGCAGCAGGAGGG + Intronic
905387112 1:37612792-37612814 CAGCAACAGCAGCAGCAGCAAGG - Exonic
905534398 1:38708949-38708971 GAGCAGCAGCAGCAGCATCGCGG - Intergenic
905805731 1:40875907-40875929 CAGCAGCAGCAGCAGCAATGTGG - Intergenic
905824073 1:41016137-41016159 CAGCAGCAGCTGCAGCAGCACGG - Exonic
906278548 1:44536687-44536709 TGGTGGCGGCAGCAGCAGAGGGG - Intronic
907011496 1:50968200-50968222 AGGCAGCAGCAGCCGCAGCCTGG + Exonic
907488075 1:54790758-54790780 CAGCAGCAGCAGCAGCAGCCAGG - Intronic
907524771 1:55047747-55047769 GGGTGGCAGCAGCAGAAGTGAGG + Intronic
907534500 1:55137544-55137566 CTCCAGCAGCAGCAGCAGTGGGG - Exonic
908107185 1:60856939-60856961 CAGCAGAAGCAGCAGCAGCAGGG + Intergenic
908825979 1:68133064-68133086 CAGCAGCAGCAGCAGCAGCAGGG + Intronic
908959625 1:69680116-69680138 CAGCAGCAGCAGCAGCATCTGGG + Intronic
909170026 1:72282963-72282985 CAGCAGCAGCAGAAGCAGCGCGG + Intergenic
911017242 1:93346184-93346206 CGGCGGCGGCAGCGGCAGCGGGG + Exonic
911660769 1:100499118-100499140 CAGAAGCAGCAACAGCAACGGGG + Exonic
912611674 1:111052924-111052946 CATTAGCAGCAGCAGCAGTGTGG - Intergenic
913334712 1:117698594-117698616 CCGAAGCAGCAGCAGGAGAGAGG + Intergenic
914826687 1:151142574-151142596 CAGCAGCAGCAGTAGCAGCAAGG + Exonic
915191870 1:154157604-154157626 AGGGAGGAGCAGCAGCAGGGTGG + Intronic
915200116 1:154221009-154221031 CGGCGGCGGCAGCGGCAGCGCGG + Intronic
915393155 1:155562436-155562458 CGGCGGCGGCAGCAGCAGAGTGG + Exonic
915409300 1:155688325-155688347 CGGCAGCGGCGGCAGCAGAGTGG + Exonic
915459430 1:156061026-156061048 CGGGAGAAGCAGCTCCAGCGGGG - Intergenic
915835386 1:159171782-159171804 CAGGAGCAGGAGCAGGAGCGAGG - Exonic
916059208 1:161087282-161087304 CTGCTGCAGCAGCAGCAGAGTGG + Intronic
916059537 1:161089234-161089256 CAGTAGCAGCAGCAGCAGCCAGG + Exonic
916562609 1:165946154-165946176 CGGCAGCAGTAGCAGCAGCAAGG + Intergenic
917109839 1:171536050-171536072 TGGCAGCAGCAGCAACAGCAAGG + Exonic
917141657 1:171841560-171841582 CCGGCGCAGCAGCAGCAGCCAGG + Exonic
917967519 1:180187810-180187832 CAGTAGCAGCAGAGGCATCGGGG + Intronic
918826984 1:189336888-189336910 TGCCAGCAGCAGCAGCAGTGTGG - Intergenic
919776483 1:201197427-201197449 CTGCAGCAGCGGCAGCAGCCTGG - Intronic
920034453 1:203056811-203056833 CAGCAGCAGCAACAGCAGCCAGG + Exonic
920178225 1:204116662-204116684 CGGCAGCAGCAGGAGCAGGTAGG + Exonic
920335349 1:205241613-205241635 CAGCAGCATCAGCAGCAGCAGGG + Exonic
920600780 1:207321821-207321843 CAGCACCAGCAGCAGCAGCCGGG - Exonic
921046195 1:211479473-211479495 TGGTTGAAGCAGTAGCAGCGTGG - Intronic
921291822 1:213664490-213664512 CAGTAGCAGCTGCAGCAGAAGGG - Intergenic
921764430 1:218953501-218953523 CAGCAGCAGCAGCAGCAGGAGGG + Intergenic
921764431 1:218953504-218953526 CAGCAGCAGCAGCAGGAGGGAGG + Intergenic
921812362 1:219529419-219529441 GAGCAGCAGCAGCAGCAGCAGGG + Intergenic
921945694 1:220884563-220884585 TAGTAGCAGCAGCACCAGTGCGG + Exonic
922472846 1:225887536-225887558 CTGTAGCAGCAGCGGCTGCCGGG + Exonic
922480858 1:225939498-225939520 CTGTAGCAGCAGCGGCTGCCGGG + Exonic
923256583 1:232226640-232226662 CAGCAACAGCAGCAGCAGCCTGG + Intergenic
923301061 1:232641157-232641179 AGGTGGCAGAAGCAGCAGCAGGG + Intergenic
923506290 1:234609196-234609218 TTGCAGCAGCAGCAGCAGCTTGG - Exonic
924458129 1:244234421-244234443 CAGCAGCAGCAGCAGCAGCCAGG - Intergenic
924705686 1:246500074-246500096 AAGGAGCAGCAGCAGCAGCAGGG - Intronic
924706285 1:246505432-246505454 CAGCAGCAGCAGCAGCACCAGGG + Intronic
924942878 1:248824800-248824822 AGGTGGAAGCAGCAGCAGTGAGG - Exonic
1063275130 10:4557657-4557679 CGGTAGCAGCAGCTCCAGGGAGG + Intergenic
1063349875 10:5344223-5344245 CAGTAGCAGCAGCAGCTGCTTGG - Intergenic
1064230824 10:13528595-13528617 CGGCAGCGGCAGCGGCGGCGCGG + Intronic
1064645341 10:17454199-17454221 CAGCAGCAGCAGCAGCAGGCTGG + Exonic
1064983199 10:21184598-21184620 CCCTAGCAGCAGCAGCAGCAGGG - Intergenic
1065041805 10:21705259-21705281 CTGTGGCAGTAGCAGCAGGGTGG + Intronic
1065189991 10:23199588-23199610 CGCTAGCAGCGACAGCAGCGGGG + Intergenic
1065712750 10:28533211-28533233 CGGCAGCAGCGGCGGCGGCGGGG + Intronic
1065879618 10:30027567-30027589 CAGCAGCAGCAGCAGCAGTGAGG - Exonic
1067031339 10:42880152-42880174 CGGGAGGAGCAGCCACAGCGGGG + Intergenic
1067472946 10:46549376-46549398 CCGGAGCAGCCGCAGCAGCTGGG + Exonic
1067560356 10:47300692-47300714 CAGCAGCAGCAGCAGCAGCTGGG - Exonic
1067724481 10:48759539-48759561 CAGCAACAGCAGCAGCAGCCAGG - Intronic
1067849580 10:49746162-49746184 CGGCAGCAGCACCAGCCGGGTGG + Intronic
1069015721 10:63427145-63427167 CGGTGGCGGCAGCAGCTGCTTGG + Intronic
1071397456 10:85237969-85237991 GAGCAGCAGCAGCAGCAGCAGGG - Intergenic
1071431100 10:85607666-85607688 TGGTAGCAGCAGGTGCACCGAGG + Intronic
1071432881 10:85619922-85619944 CGGCAACAGCATCAGCAGCAAGG - Exonic
1071611722 10:87038202-87038224 CGGCAGTGGCAGCAGCAGCATGG + Intergenic
1072047590 10:91672226-91672248 TAGCAGCAGCAGCAGCAGCAGGG - Intergenic
1072189052 10:93066011-93066033 CAGTAGCAGCAGGACGAGCGAGG - Exonic
1072242442 10:93509418-93509440 GGCCAGCAGCAGCAGCAGCTAGG - Intronic
1072336611 10:94403285-94403307 CAGCAGCTGCAGCAGTAGCGAGG + Exonic
1072562199 10:96586773-96586795 CAGCAGCAGCAGCCACAGCGCGG + Exonic
1072733748 10:97865655-97865677 CAGTGGCAGCAGCAGCGGTGGGG + Exonic
1073535094 10:104269183-104269205 CGGCGGCAGCAGCAGCAAGGAGG - Exonic
1074458530 10:113615894-113615916 AGGTGGCAGCTGCAGCAGCTTGG - Intronic
1074731356 10:116379869-116379891 CGGTGGCAGCAGGAGCAAAGTGG - Exonic
1074979248 10:118606439-118606461 GGGCAGCAGCAGCAGCATCTGGG + Intergenic
1075520373 10:123140103-123140125 CTGTTGCAGCTGCAGCAGCTAGG - Intergenic
1076140872 10:128077734-128077756 CAGAAGCAGCAGCAGCAGACAGG + Exonic
1076165451 10:128278718-128278740 CGGGATGAGCAGCAGCATCGTGG - Intergenic
1076372957 10:129966865-129966887 GGGCAGGAGCAGCAGCAGAGGGG + Intergenic
1077103683 11:832976-832998 CGGCGGCGGCAGCAGCTGCGGGG - Exonic
1077214120 11:1388290-1388312 CACTCACAGCAGCAGCAGCGGGG + Intergenic
1077976914 11:7256292-7256314 CAGCAGCAGCAGCAGCTGCTGGG + Intronic
1078074796 11:8148794-8148816 CAGCAGCAGCAGCAGCAGCAGGG + Intronic
1078245993 11:9573745-9573767 CGGTGGCGGCAGCGGCGGCGCGG - Exonic
1078474926 11:11622005-11622027 CGGCAGCGGCAGCGGCGGCGGGG + Exonic
1078544571 11:12237748-12237770 CAGGAGCAGCAGCAGCAGCTGGG + Intronic
1079128435 11:17734591-17734613 CGGGAGCAGCAGGAGCCGCGCGG + Intergenic
1079686911 11:23370663-23370685 AGGTAACATCAGCAGCAGCCTGG + Intergenic
1080394211 11:31875069-31875091 CAGTAGCAGGAGCAGCAGGAGGG - Intronic
1080798969 11:35591624-35591646 CAGAAGCAACAGCAGCAGCATGG - Intergenic
1081801080 11:45859766-45859788 CAGCAGCAGCAGCAGCAGGAGGG - Intronic
1081812824 11:45922920-45922942 CAGCAGCAGCAGCAACAGCGCGG - Exonic
1082004553 11:47412363-47412385 CTGCAGCAGCAGCAACAGCTGGG + Exonic
1082868519 11:57921147-57921169 GGGTAGTAGCAGCAGCAGGCTGG - Intergenic
1083363906 11:62129902-62129924 CGGCAGCTGCAGCCGCAGCACGG - Exonic
1083448534 11:62727101-62727123 CGGTCGGAGCTGCAGCGGCGGGG - Exonic
1083729065 11:64643300-64643322 CGGCAGCGGCAGCAGCGGCGCGG - Intronic
1083747699 11:64744812-64744834 CGGGAGCCGCAGCCGCAGCGAGG - Intronic
1083851310 11:65369040-65369062 CAGCAGCAGCAGCAGCATCTGGG + Intergenic
1084086581 11:66857749-66857771 CAGCAGCAGCAGGAGCGGCGGGG - Exonic
1084172410 11:67406861-67406883 CGGAAGCAGCCGCCGCAGCAGGG - Exonic
1084333177 11:68441563-68441585 GGGTTGCAGCAGCAGGAGCAGGG - Intronic
1084697038 11:70761915-70761937 CAGCAGCAGCAGCAGCAGCCGGG - Intronic
1084738220 11:71119792-71119814 CGGCAGCAGCAGTAGCACCTTGG - Intronic
1084741205 11:71140601-71140623 GGGTAGCACCAGCAGGAGGGTGG + Intronic
1084837484 11:71813527-71813549 CGCGAGAAGCAGCGGCAGCGAGG - Intergenic
1084860436 11:72014504-72014526 GGGCAGCAGCAGGAGGAGCGTGG - Exonic
1085808426 11:79658078-79658100 CAGAAGCATCAGCATCAGCGGGG + Intergenic
1086455368 11:86955098-86955120 GGGTAGCAGCGGCAGCGGCTGGG + Exonic
1086486912 11:87315117-87315139 CAGTAGCAGCAGTAGTAGGGGGG - Intronic
1087144649 11:94799803-94799825 CAGCAGCAGCAACAGCAGCAGGG + Exonic
1087392058 11:97548443-97548465 CAGCAGCAGCAGCAGCAGCCTGG + Intergenic
1087954856 11:104273268-104273290 CTGTAGCAGCATGAGCAGCAGGG + Intergenic
1088400883 11:109422148-109422170 CGGCGGCGGCGGCAGCAGCGCGG + Exonic
1089499289 11:118923124-118923146 GGGTTGCAGCAGCAGCTGCCGGG - Intronic
1089572440 11:119419453-119419475 CAGGAGCAGCAGCAGCCACGAGG + Exonic
1089615500 11:119692506-119692528 CCTTAGCAGCAGCAGAAGCTGGG + Intronic
1091111352 11:132971927-132971949 CAGCAGCAGTAGCAGCAGGGTGG - Intronic
1091111353 11:132971930-132971952 CGGCAGCAGCAGTAGCAGCAGGG - Intronic
1091293232 11:134454106-134454128 CAGCAGCAGCAGCAGAAGCAGGG - Intergenic
1091594335 12:1865655-1865677 CAGCAGCAGCAGCAGCACCAGGG + Intronic
1092153091 12:6264566-6264588 TGGCAGCAGCAGCAGAAGCAGGG + Intergenic
1092257794 12:6936759-6936781 CAGCAGCAGCAGCAGCATCACGG + Exonic
1093170851 12:15858792-15858814 CTGTAGCAGCAGCAGAATCCAGG + Intronic
1093406754 12:18813727-18813749 GGCTAGCAGCAGCAGCAGTGGGG + Intergenic
1093465020 12:19440023-19440045 TGAGAGCAGCAGCAGCGGCGGGG + Exonic
1093465040 12:19440128-19440150 CGCCGCCAGCAGCAGCAGCGGGG + Exonic
1093518885 12:20024467-20024489 GAGTGGCAGCAGCAGCAGCAGGG + Intergenic
1094523408 12:31216166-31216188 CAGAAGCAGCAGCAGCAGTGAGG - Intergenic
1095792723 12:46185232-46185254 CAGTAGCATCAGCATCATCGGGG - Intronic
1096009894 12:48203977-48203999 CGGTAGCAGCAGCAACTGCTGGG - Intergenic
1096180698 12:49548986-49549008 CAACTGCAGCAGCAGCAGCGAGG + Exonic
1096476832 12:51913678-51913700 CGGAGGCAGGAGAAGCAGCGTGG + Exonic
1096848162 12:54419109-54419131 CAACAGCAGCGGCAGCAGCGGGG + Exonic
1096863838 12:54549625-54549647 CGGCAGCAGCAGCGGCGGTGCGG + Exonic
1097053069 12:56235211-56235233 CAGGAGCCGCAGCAGCAGCAGGG - Exonic
1097192312 12:57225401-57225423 GGATGGCAGCAGCAGCGGCGGGG + Exonic
1100243456 12:92732963-92732985 CACGACCAGCAGCAGCAGCGGGG + Intronic
1100415543 12:94369884-94369906 AAGCAGCAGCAGCAGCAGCAAGG + Intronic
1101510590 12:105389291-105389313 CGGCAGCAGCAGCAACAGTGGGG - Intronic
1101981008 12:109406893-109406915 GGGAGGCAGCAGCAGCAGGGAGG - Intronic
1102347204 12:112167844-112167866 CAGCAGCAGCAGCGACAGCGAGG + Exonic
1102487155 12:113266289-113266311 GGAGAGCAGCAGCAGCAGCAGGG - Exonic
1102772315 12:115488913-115488935 AGGTAGCAGGAACAGCAGCTGGG + Intergenic
1102965031 12:117119133-117119155 AGCCAGCAGCAGCAGCAGCTTGG - Intergenic
1103074154 12:117968888-117968910 CAGCAGCAGCAGCAGCAGCGCGG - Intronic
1103339671 12:120214838-120214860 CCGTTGCAGTAGTAGCAGCGCGG + Exonic
1103445547 12:120992864-120992886 GGGGCGCAGCAGCAGCAGCAGGG - Intronic
1103694075 12:122799912-122799934 TGGTGGCAGCGGCAGCAGCTAGG - Intronic
1103956855 12:124582220-124582242 CAGCAGCAGCAGCACCAGCCTGG - Intergenic
1104021248 12:124993828-124993850 CAGCAGCAGCAGCAGGAGCCCGG - Exonic
1104053083 12:125209382-125209404 CGCTAGCAGTGGCAGCAGAGTGG + Intronic
1104530502 12:129565700-129565722 TGGGAGCTGCAGTAGCAGCGAGG - Intronic
1104642008 12:130473416-130473438 CAGGAGCAGCAGCAGCATCTGGG + Intronic
1104714955 12:131010603-131010625 CGGAAGGCGGAGCAGCAGCGTGG + Intronic
1104843186 12:131834336-131834358 CGGGTGCTGCAGCAGCAGCAGGG - Intronic
1104846840 12:131851201-131851223 CGGCAGCAGCAGCAGCATGGTGG - Exonic
1104846841 12:131851204-131851226 TGGCGGCAGCAGCAGCAGCATGG - Exonic
1104857778 12:131909939-131909961 CAGGAGCAGCTGCCGCAGCGGGG - Exonic
1105209379 13:18248926-18248948 AGTCAGCAGCAACAGCAGCGGGG + Intergenic
1105752781 13:23436834-23436856 CGGTAGGAGCAGCAGCTGGGAGG - Intergenic
1105851557 13:24340291-24340313 CGGTAGCAGCGGGAGGAGCTGGG + Intergenic
1106226930 13:27793017-27793039 CGGCAGCAGCAGCGGCGGCCGGG - Exonic
1106250162 13:27976917-27976939 CAGCAGCAGCAACAGCAGCAAGG - Intergenic
1106995557 13:35476295-35476317 CAGCAGCAGCAGCAGCAGCAGGG - Exonic
1107058521 13:36131250-36131272 CGGCAGCAGCTGCTGGAGCGCGG + Exonic
1107276712 13:38687427-38687449 CAGCAGCAGCAGCAGCAGCCGGG - Exonic
1107826439 13:44332727-44332749 AGGCAGCAGCAGCAGCAGGGAGG - Intergenic
1107826440 13:44332730-44332752 TGGAGGCAGCAGCAGCAGCAGGG - Intergenic
1107899255 13:44995822-44995844 CAGCAGCAGCAGCAGCAGCTGGG - Intronic
1109134135 13:58625711-58625733 TGGCAGCAGCAGCAGCAGGCAGG - Intergenic
1109495633 13:63168154-63168176 CAGCAGCAGCAGCAGCATCAGGG + Intergenic
1110630147 13:77698080-77698102 CGGCAGCAGCAGCAGGTGCGGGG - Intronic
1111512808 13:89287878-89287900 GGGTGGCTGCAGCAGCAGCCAGG + Intergenic
1112294780 13:98177086-98177108 CGGAGAGAGCAGCAGCAGCGGGG - Exonic
1113301211 13:109021473-109021495 CAGCAGAAGCAGCAGCAGTGTGG + Intronic
1113462461 13:110491707-110491729 AAGCAGCAGCAGCAACAGCGTGG - Intronic
1114519007 14:23321483-23321505 CGGCGGCGGCAGCAGCAGCGGGG + Exonic
1115027107 14:28758569-28758591 CGCTAGGAGCTGCAGCTGCGAGG + Intergenic
1115850754 14:37588214-37588236 CGGGAGCAGCCGCGGCAACGCGG + Intergenic
1116441785 14:44962438-44962460 GGGCGGCAGCAGAAGCAGCGCGG - Exonic
1116484730 14:45433975-45433997 CGGCAGCAGCAGCAGCAGCAGGG + Intergenic
1116725265 14:48554767-48554789 CAGCAGCAGCAGCAGCAGAGTGG - Intergenic
1117860916 14:60091968-60091990 GCCTAGCAGAAGCAGCAGCGGGG - Exonic
1118654500 14:67932628-67932650 GGGTAGTGGCAGCAGCAGTGAGG + Intronic
1118859650 14:69652702-69652724 AGGCAACAGCAGCAGCAGCTAGG - Intronic
1119395168 14:74320924-74320946 CAGCAGCAGCAGCAGCAGCAAGG + Intronic
1119573753 14:75699685-75699707 GAGAAGCAGCAGCAGTAGCGAGG - Intronic
1119618567 14:76114493-76114515 CAGCAGCAGCAGAAGCAGCATGG + Intergenic
1119634664 14:76264194-76264216 TGGCAGCAGGAGCAGCAGAGAGG + Intergenic
1120525226 14:85569378-85569400 CCGTACCAGGAGCAGCAGGGAGG + Intronic
1121013616 14:90535450-90535472 CCAGAGCAGCAGCAGCAGGGAGG - Exonic
1121070340 14:91013742-91013764 GACCAGCAGCAGCAGCAGCGTGG + Intronic
1121195847 14:92071009-92071031 CAGCAGCAGCAGCAGCAGCAGGG - Exonic
1121262631 14:92577515-92577537 CGGCAGCAGCAGCAGCAGAGAGG + Intronic
1121711050 14:96039452-96039474 CAGCGGCAGCGGCAGCAGCGAGG + Exonic
1122081692 14:99271296-99271318 CGGCAGCGGCGGCAGCGGCGCGG - Intronic
1122198236 14:100105814-100105836 TTGTAGCAGCAGCAGCCGCTTGG + Intronic
1122723676 14:103736387-103736409 CGGCAGCAGGAGCAGCAGCTGGG - Intronic
1122871326 14:104640409-104640431 CGGGGGCAGCTGCAGCAGAGGGG - Intergenic
1122975269 14:105168370-105168392 CAGCAGCAGCAGCAGCCGCCGGG + Exonic
1123024891 14:105419899-105419921 CGGCGGCGGCGGCAGCAGCGCGG + Exonic
1125158246 15:36614213-36614235 AGGGAGGAGCAGCAGCAGGGTGG - Intronic
1125301043 15:38253114-38253136 GGGGAGCAACAGCAGCACCGAGG - Exonic
1125435960 15:39645660-39645682 GGGCAGCAGCAGCTGCAGCCAGG - Intronic
1125933958 15:43618681-43618703 CAGCAGCAGCAGCAGCAGCAGGG + Exonic
1125947055 15:43718143-43718165 CAGCAGCAGCAGCAGCAGCAGGG + Intergenic
1126844019 15:52742595-52742617 GGGTGGCAGCAGCAGCTGCACGG - Intergenic
1127003157 15:54534072-54534094 TGGTGGCAGCAGCAGCACAGTGG - Intronic
1127428580 15:58880435-58880457 CAGCAGCAGCAGCACCAGCTGGG + Intronic
1127893703 15:63277237-63277259 CGGGAGCAGGAGCTGCGGCGTGG + Intronic
1128513836 15:68329735-68329757 TGGTGGCAGCAACAGCAGCCTGG - Intronic
1129332278 15:74833798-74833820 GGGGAGCAGCAGCAGCACTGAGG + Intergenic
1129538952 15:76335996-76336018 CAGCAGCGGCAGCAGCAGCAAGG + Intergenic
1129607095 15:77030314-77030336 GAGCAGCAGCAGCACCAGCGTGG + Intronic
1130957690 15:88639084-88639106 CGGGAGCTGGAGCAGCAGCTGGG + Intronic
1131032725 15:89199958-89199980 CCGAGGCAGCAGCAGCAGAGGGG - Exonic
1131080548 15:89531034-89531056 AGATAGCAGCAGCACCAGCTGGG + Intergenic
1131466054 15:92655615-92655637 CAGCAGCAGCGGCAGGAGCGGGG + Exonic
1132199737 15:99943275-99943297 CACGAGCAGCTGCAGCAGCGTGG + Intergenic
1132712744 16:1276712-1276734 CAGCAGCAGCAGCAGCTGCGGGG + Intergenic
1132953078 16:2575729-2575751 GAACAGCAGCAGCAGCAGCGAGG + Intronic
1132961273 16:2624439-2624461 GAACAGCAGCAGCAGCAGCGAGG - Intergenic
1133029718 16:3004609-3004631 CGGAAGCAGCGGTAGGAGCGCGG - Intergenic
1133129212 16:3665842-3665864 TGGCAGCAGCAGCAGCAGCCAGG + Intronic
1133138458 16:3728397-3728419 CAGCAACAGCAGCAGCAGCAAGG - Exonic
1133288281 16:4701487-4701509 CCAGAGCAGCAGCAGCAGCGAGG - Exonic
1133288418 16:4702102-4702124 CAGCAGCAGCAGCAGCAGTCGGG - Exonic
1133303317 16:4795951-4795973 CAGCAGCAGCAGGAGCAGCACGG - Exonic
1133845491 16:9449667-9449689 CAGTAGCTGCAGCAGCAGCAGGG + Intergenic
1134143590 16:11742685-11742707 CGGCGGCAGCAGCAGCAGCGAGG - Exonic
1134163979 16:11915642-11915664 CGGCAGCAGCAGCAGCGACTCGG - Exonic
1135382732 16:22008128-22008150 CGGGACCAGCAGCCGCGGCGCGG - Intronic
1135929921 16:26727809-26727831 CGGTAGCAGCAAAAGCAGTTAGG + Intergenic
1136019340 16:27430094-27430116 CTGGAGCAGCAGCAGGAGCAAGG - Exonic
1136511007 16:30738333-30738355 CGGCGGCGGCGGCAGCAGCGGGG + Exonic
1136561547 16:31042144-31042166 CGGCAGCGGCAGCAACAGCAGGG - Intronic
1137655305 16:50153771-50153793 CAGCAGCAGCAGCAGCAGCACGG + Exonic
1137775014 16:51047213-51047235 CAGAAGCAGCAGCAGCAGCTGGG + Intergenic
1137938221 16:52656063-52656085 AGGGAGGAGCAGCAGCAGGGTGG - Intergenic
1138166654 16:54808118-54808140 CAGCAGCAGCAGCAGCATCTGGG - Intergenic
1138360768 16:56425499-56425521 GGGCAGCAGCGGGAGCAGCGCGG - Exonic
1138382051 16:56609259-56609281 GGGCAGCAGGAGCAGCAGCCTGG - Exonic
1138383338 16:56618585-56618607 GGGCAGCAGGAGCAGCAGCCTGG - Intergenic
1138385600 16:56633747-56633769 GGGCAGCAGGAGCAGCAGCCTGG - Exonic
1138386153 16:56636848-56636870 GGGCAGCAGAAGCAGCAGCCTGG - Intergenic
1138386651 16:56639855-56639877 GGGCAGCAGGAGCAGCAGCCTGG - Exonic
1138388029 16:56649419-56649441 GGGTAGCAGGAGCAGCAGTCTGG - Intronic
1138389408 16:56659069-56659091 GGGCAGCAGGAGCAGCAGCCTGG - Exonic
1138390459 16:56666952-56666974 GGGCAGCAGGAGCAGCAGCCTGG + Exonic
1138392155 16:56677648-56677670 GGGCAGCAGGAGCAGCAGCCTGG - Exonic
1138393059 16:56683954-56683976 GGGCAGCAGGAGCAGCAGCCTGG - Exonic
1139099189 16:63744640-63744662 TAGCAGCAGCAGCAGCAGCAGGG - Intergenic
1139347963 16:66316642-66316664 CAGCAGCAGCAGCAGCAGCAGGG - Intergenic
1139392822 16:66615982-66616004 CAGGAGAAGCAGCAGCAGAGAGG + Exonic
1139459410 16:67109967-67109989 CTGCAGCAGCCGCGGCAGCGGGG - Exonic
1140392867 16:74603114-74603136 CAGCAGCAGCAGCAGCAGCCAGG + Intronic
1140851162 16:78935932-78935954 AAGCAGCAGCAGCAGCAGCTAGG + Intronic
1141128311 16:81416953-81416975 CGGCAGCAGCAGCAGCAGCTAGG + Intergenic
1141160149 16:81624010-81624032 CTGTATCAGCAGAAGCAGAGGGG - Intronic
1141553251 16:84820058-84820080 CGGTAGCAGCGGCGACAGCGCGG - Exonic
1141698980 16:85633816-85633838 CGGTGTCAGCAGCAGCAGGCAGG - Intronic
1141989612 16:87602573-87602595 CGGCAGCAGCAGCAGCAATGCGG - Intronic
1142338963 16:89508422-89508444 ACGGAGCAGCAGCAGCAGCACGG - Exonic
1142698925 17:1648156-1648178 GGGTTGCAGCTGCAGCAGCCAGG - Intronic
1143130729 17:4675321-4675343 GGGCAGCAGCAGCAGCCGCAGGG + Exonic
1143147538 17:4786311-4786333 CAGCAGCAGCGGCAGCAGCTTGG + Exonic
1143411702 17:6713253-6713275 GAGTGGCAGCAGCAGGAGCGGGG + Exonic
1144137756 17:12314618-12314640 CAGTGGCAGCAGCAGGAGGGTGG + Intergenic
1146390451 17:32417400-32417422 TGATAGCAGCAGCTGCAGGGAGG + Intergenic
1147262786 17:39218268-39218290 CAGCAGCAGCAGCAGCAGCGTGG + Intronic
1147613158 17:41813078-41813100 CAGTAGCAGCAACTGCAGCAGGG - Exonic
1148821946 17:50364945-50364967 CAGCAGCAGCAGCAGCAGGATGG - Intergenic
1149634695 17:58157222-58157244 CGGCAGCAGCAGTAGCCGCAGGG - Intergenic
1149665669 17:58363390-58363412 CTGTAGCTGCAGCAGCCGCTGGG - Exonic
1150311086 17:64130000-64130022 CAGCAGCAGCAGCAGCCGCCGGG + Exonic
1150484123 17:65532421-65532443 AAGCAGCAGCAGCAGCAGCCAGG + Intronic
1151165811 17:72202839-72202861 CAGCAGCAGCAGCAGGAGTGAGG - Intergenic
1151674067 17:75589016-75589038 CGGGAGCCGCAGCAGGAGCGGGG + Intergenic
1152415828 17:80161167-80161189 GAGGAGCAGCAGCAGCAGCAGGG + Intergenic
1152651377 17:81495056-81495078 GAGCAGCAGCAGCAGCAGCAGGG - Intergenic
1152698804 17:81809044-81809066 CAGCAGCAGCAACAGCAGCAGGG - Exonic
1153514385 18:5891004-5891026 CGCTAGCAGCTGCAGCAGTCCGG - Exonic
1153794385 18:8609435-8609457 CAGTAGCGGCAGCAGCATCCCGG - Exonic
1154019271 18:10648242-10648264 CAGCAGCAGCAGCAGCATAGTGG - Intergenic
1155528702 18:26743918-26743940 CGGCAGCATCAGCATCAGCAGGG - Intergenic
1155654345 18:28177099-28177121 CGGCAGCACCAACAGCGGCGCGG + Exonic
1155654517 18:28177784-28177806 CGGCTGCGGCAGCAGCTGCGCGG - Intergenic
1156099620 18:33578349-33578371 CGGGGGCGGCGGCAGCAGCGGGG - Intergenic
1156294067 18:35774106-35774128 CAGAAGCTGCAGCAGCAGAGGGG - Intergenic
1156483706 18:37451767-37451789 AGGGAACAGCACCAGCAGCGGGG - Intronic
1156666814 18:39418594-39418616 AAGAAGCAGCAGCAGCAGCAAGG + Intergenic
1156791186 18:40976506-40976528 TGGTGGCAGCAGCAGTAGCAAGG + Intergenic
1156958442 18:42994732-42994754 GGGCAGCAGCAGCCGCTGCGTGG - Intronic
1157991115 18:52497759-52497781 CAGTAGCAGCAGCATCACCACGG + Intronic
1158976544 18:62715869-62715891 CGGGAACGGCAGCGGCAGCGGGG + Exonic
1159921072 18:74227822-74227844 CAGCAGCAGCAGCAGCAGAAAGG + Intergenic
1160057681 18:75499998-75500020 CAGCAGCAGCAGCAGCATCCAGG + Intergenic
1160377372 18:78423188-78423210 CGGCAGCAGCAGCAATAGCAGGG - Intergenic
1160541565 18:79626831-79626853 TGGGGGCAGCAGCTGCAGCGTGG - Intergenic
1160779829 19:872787-872809 GGGCAGCAGCAGCAGAAGCAAGG + Intronic
1160865096 19:1252847-1252869 CAGCAGCAGCAGCAGTGGCGTGG + Intronic
1161009973 19:1955294-1955316 CAGCAGCAGCAGCAGCAGGAGGG - Intronic
1161468807 19:4446345-4446367 CGGGAGAAGGAGGAGCAGCGGGG - Exonic
1161477444 19:4494343-4494365 GGGCAGCGGCGGCAGCAGCGGGG + Exonic
1162068219 19:8138280-8138302 GGGTAGCAGCGGCAGCCGCTGGG + Exonic
1162481105 19:10927682-10927704 CAGCAGCAGCAGCAGCAGCCGGG - Exonic
1163155700 19:15438955-15438977 GGGCAGCAGCAGCAGCTCCGAGG - Intronic
1163836878 19:19580372-19580394 CGGTAGCAGCAGCAAGACCCTGG - Intronic
1165432569 19:35780985-35781007 CGGCAGCGGCTGCGGCAGCGGGG + Exonic
1166364856 19:42273133-42273155 CGGCAGCCGCAGCAGCAGCGTGG + Intronic
1166748339 19:45152509-45152531 CTGCAGCAGCAGCAGCAGCAGGG - Exonic
1167341992 19:48921854-48921876 CAGCAGCAGCAGCAGCAGCAAGG + Exonic
1167443681 19:49525045-49525067 CAGCAGCAGCAGCAGCAGGATGG - Intronic
1167556500 19:50199450-50199472 GGGTATCAGCTGCAGCAGAGAGG - Intronic
1167581311 19:50344708-50344730 CAGAGGCAGCAGCAGCAGCAAGG + Intronic
1167584424 19:50365574-50365596 CAGAGGCAGCAGCAGCAGCAGGG + Exonic
1168000565 19:53442620-53442642 AGGAAGGAGCAGCAGCAGGGTGG - Intronic
1168005060 19:53480104-53480126 AGGAAGGAGCAGCAGCAGGGTGG - Intronic
1168246994 19:55117455-55117477 CGGGAGCAGCTGCGGCAGTGGGG - Exonic
1168712892 19:58511911-58511933 GAGCAGCAGCAGCAGCAGCAAGG + Exonic
1168714044 19:58516920-58516942 CGCTGTCAGCAGCAGCAGTGAGG + Exonic
924971687 2:133829-133851 GGAAAGCAGCGGCAGCAGCGAGG + Intergenic
925609914 2:5693768-5693790 CAGCAGCGGCAGCAGCGGCGAGG + Exonic
926115762 2:10212260-10212282 CAGCAGCAGCAGCAGCAGAAGGG - Intergenic
927181001 2:20446850-20446872 CCGCAGCGGCAGCAGCAGCGCGG + Intergenic
927217735 2:20677968-20677990 CAGCAGCAGCAGCAGCAGCTGGG + Intergenic
927256360 2:21043907-21043929 CGCCAGCAGCGCCAGCAGCGCGG + Exonic
927708614 2:25311963-25311985 CCAGAGCAGCAGCAGCGGCGTGG + Intronic
927937119 2:27082366-27082388 TGGCGGCAGCAGCAGCAGTGGGG + Exonic
927971373 2:27307842-27307864 CTGTACCAGGAGCAGCAGCGCGG + Exonic
928097269 2:28412379-28412401 CCGCAGAAGCAGTAGCAGCGGGG + Exonic
928391470 2:30914054-30914076 CAGCAGCAGCAGCAGCAGCCTGG - Intronic
928647542 2:33370480-33370502 CAGCAGCAGCAGCAGCAGCTTGG - Intronic
929265941 2:39919825-39919847 AGACAGCAGCAGCAGCAGCAAGG + Intergenic
929590562 2:43143061-43143083 CAGCAGCAGCAGCAGGAGGGAGG - Intergenic
929590563 2:43143064-43143086 AGGCAGCAGCAGCAGCAGGAGGG - Intergenic
929604195 2:43224599-43224621 CAGCAGCAGCAGCAGCAGCAGGG - Exonic
929604360 2:43225373-43225395 CTGCAGCAGCAGCAGAAGGGGGG - Exonic
929604396 2:43225533-43225555 CGGCAGCAGCTGCGGCAGCGCGG - Exonic
929926666 2:46217920-46217942 CCCTGGCAGCAGCAGCAGCATGG - Intergenic
930092583 2:47541987-47542009 CAGCAGCAGCAGCGGCAGCAGGG + Intronic
930096428 2:47570252-47570274 CAGCAGCAGCAGCAGCAGGAGGG + Exonic
931881394 2:66574868-66574890 CAGCCGCAGCAGCAGCAGCAGGG + Intergenic
931909895 2:66887820-66887842 CAGCAGCAGCAGCAGCAGCAGGG + Intergenic
932593710 2:73081500-73081522 CGGCAGCAGTGGCAGCAGCGGGG + Intronic
933336321 2:80964195-80964217 TAGCAGCAGCAGCAGCAGCATGG + Intergenic
933336322 2:80964198-80964220 CAGCAGCAGCAGCAGCATGGTGG + Intergenic
933649627 2:84840112-84840134 TGGAAGCAGCAGCAGCAGGCAGG - Intronic
935220504 2:101008294-101008316 AGGTAGCAGCAGAACCAGGGTGG + Intronic
935312676 2:101801080-101801102 AGAAAGCAGCAGCAGCAGCTGGG - Intronic
936147163 2:109987641-109987663 CGCTGTCAGCAGCAGCAGTGAGG + Intergenic
936197529 2:110383842-110383864 CGCTGTCAGCAGCAGCAGTGAGG - Intergenic
936502789 2:113079459-113079481 AGGTAGCACCAGGAGCAGGGTGG + Intergenic
936781624 2:116039827-116039849 CAGCAGCAGCAGCAGCATCTGGG - Intergenic
937022525 2:118671364-118671386 CAGCAACAGCAGCAGCAGCAGGG - Intergenic
937024073 2:118682873-118682895 CAGCAGCAGCAGCAGCACAGAGG - Intergenic
937303023 2:120854860-120854882 CAGCAGCAGCAGCAGCATCTGGG - Intronic
937844085 2:126558232-126558254 CGGCGGCGGCAGCAGCGGCGAGG + Intergenic
938421086 2:131147385-131147407 AGTGAGCAGCAGCAGCAGCTAGG - Exonic
938458830 2:131484585-131484607 CAGCGGCAGCAGCAGCAGCAGGG + Intronic
938483743 2:131682512-131682534 CCCCTGCAGCAGCAGCAGCGTGG + Intergenic
938566846 2:132526317-132526339 CTGTAGAAGCTGCAGCAGTGAGG + Intronic
939244934 2:139610726-139610748 CCCCAGCAGCAGCAGCAGTGTGG - Intergenic
941264140 2:163338524-163338546 CAGCAGCAGCAGCAGCAGTACGG + Intergenic
941933238 2:170963422-170963444 CAGCAGCAGCAGTAGCAGCGGGG - Intronic
942178163 2:173354868-173354890 CAGGAGGAGCAGCAGCAGCGCGG - Exonic
942241035 2:173964439-173964461 CTGCAGCAGCAGCAACAGCACGG - Exonic
942241409 2:173965827-173965849 CGGCCGCAGCAGCAGCCCCGGGG - Intergenic
942737912 2:179137627-179137649 CTGTAACAGCAGCAGCAGTATGG + Intronic
943653435 2:190481828-190481850 ACTTAGCAGCAGCAGCAGCATGG - Intronic
944610716 2:201403455-201403477 CGGTAGAAACAGCAGCACAGTGG - Intronic
944655538 2:201873520-201873542 CAGCTGCAGCAGCAGCAGCATGG - Intronic
944743660 2:202635320-202635342 CAGCAGCAGCAGCAGCAACATGG + Exonic
945251368 2:207768689-207768711 TAGGAGCAGCAGCAACAGCGAGG + Exonic
945357425 2:208856762-208856784 CTGCAGCAGCAGTAGCAGAGGGG + Intergenic
946019842 2:216633546-216633568 CGGCGGCGGCAGCGGCAGCGCGG - Exonic
946103659 2:217351002-217351024 TGCCAGCAGCAGCAGCAGTGTGG + Intronic
946977060 2:225164719-225164741 CAGCAGCAGCAGCAGCAGCAAGG - Intergenic
947118379 2:226795330-226795352 CGGTAGCAGCAGCAGCAGCGAGG - Exonic
947314024 2:228835578-228835600 AGACAGCAGCAGCAGCAGCAAGG - Intergenic
947488399 2:230573130-230573152 AGGGAGGAGCAGCAGCAGGGTGG + Intergenic
947944755 2:234092020-234092042 CGTCAGCAGCTGCAGCAGCCAGG - Intergenic
948006851 2:234616801-234616823 CGGCAGTAGCAGCAGAAGCGAGG + Intergenic
948350504 2:237336216-237336238 GTTTTGCAGCAGCAGCAGCGGGG + Exonic
948843986 2:240674525-240674547 TGGCAGCAGAAGCAGCAGCAGGG - Intergenic
948849826 2:240700110-240700132 TGGCAGCAGAAGCAGCAGCAGGG + Intergenic
948992760 2:241563151-241563173 CGGGAGCAGCAGGAGCAGGGAGG - Intronic
1168771890 20:420871-420893 CGGAAGCAGCAGCAGCAGGAGGG + Exonic
1169065614 20:2692925-2692947 GAGCAGCAGCAGCAGCAGCCCGG - Exonic
1169111295 20:3035892-3035914 CAGAAGCAGCAGCAGCAGTCAGG + Exonic
1169195917 20:3681951-3681973 TAGTAGCAGCAGCAGCAACGGGG + Exonic
1169255051 20:4090884-4090906 TGGTGGCAGCAGCAGCATCCTGG - Intergenic
1170138480 20:13101817-13101839 CAGTAGCAGCAGCGGCACCCAGG - Intronic
1170150524 20:13221793-13221815 CCCCAGCAGCAGCAGCAGCTCGG - Exonic
1170330200 20:15201049-15201071 CAGCAGCAGCAGCAGCACCTGGG - Intronic
1170624523 20:18021221-18021243 AGGCAGCAGCAGCAGCAGTAGGG - Intronic
1170629729 20:18056791-18056813 CGGCAGCGGCAGCAGCAGCGCGG - Exonic
1170664887 20:18378290-18378312 CAGGACCAGAAGCAGCAGCGAGG + Intergenic
1170781326 20:19428148-19428170 CAGTAGCAGCAGCATGAGCCCGG + Intronic
1170853224 20:20022963-20022985 CGGCAGCAGAAACAGCAGAGGGG + Intronic
1170855299 20:20047704-20047726 CAGGAGCAGCAGCAGCATCCAGG + Intronic
1170924745 20:20712594-20712616 CGGCGGCGGCGGCAGCAGCGGGG - Intergenic
1171424692 20:25042250-25042272 CAGTGGCAGCAGCCGCAGCCTGG + Intronic
1171847145 20:30284084-30284106 CGGCGGCAGCAGGAGCATCGCGG + Intergenic
1172042296 20:32053868-32053890 CAGCAGCAGCAGCATCACCGGGG - Intronic
1172167636 20:32908611-32908633 CAGCAGCAGCAGCTGCAGAGAGG - Intronic
1172506613 20:35467435-35467457 GGCTAGTAGCAGCAGCAGCTGGG - Exonic
1172970930 20:38872620-38872642 CAGCAGCAGCAGCAGCACCTGGG - Intronic
1173179746 20:40796825-40796847 GGGCAGGAGCAGCAGCAGAGTGG - Intergenic
1173855997 20:46251220-46251242 CAGCAGCAGCAGCAGTAGCGCGG + Exonic
1174053915 20:47785433-47785455 CGGCAGCGGCAGCGGCGGCGCGG - Intronic
1174371303 20:50089994-50090016 AGGTGCCAGCAGCAGCAGAGGGG + Intronic
1174734998 20:52957392-52957414 CAGCAGCAGCAGCAGCACCTGGG + Intergenic
1174882166 20:54291869-54291891 CAGCAGCAGCAGCAGCAGCAGGG + Intergenic
1175116132 20:56683811-56683833 CTGGAGCAGAAGCAGCAGAGAGG + Intergenic
1175166058 20:57045480-57045502 CTGCAGCATCAGCAGCATCGGGG + Intergenic
1175501060 20:59451160-59451182 TAGAAGCAGCAGCAGCAGCAAGG - Intergenic
1175504380 20:59471167-59471189 GGGAAGCAGCAGCTGCAGTGAGG + Intergenic
1175564049 20:59958752-59958774 CACTAGAAGCAGCAGCAGCGAGG - Exonic
1175786822 20:61717195-61717217 CTGTGACAGCAGCAGCAGTGGGG - Intronic
1175834884 20:61987081-61987103 CAGCAGCAGCAGCAACAGCCAGG + Intronic
1175997172 20:62817087-62817109 CAGGAGCAGGAGCAGGAGCGGGG - Exonic
1176680256 21:9815602-9815624 CGGCGGCAGCAGGAGCATCGCGG - Intergenic
1176680538 21:9817011-9817033 CGGCGGCAGCAGGAGCATCGCGG - Intergenic
1176684753 21:9838120-9838142 CGGCGGCAGCAGGAGCATCGCGG - Intergenic
1177006893 21:15684631-15684653 CAGTAGCATCAGCAGCAACTAGG + Intergenic
1177183203 21:17765798-17765820 CTGTAGCATCAGCATCAGCTGGG + Intergenic
1177237569 21:18412722-18412744 CAGCAGCAGCAGCAGCAGCAGGG - Intronic
1178319994 21:31597904-31597926 CGGCGGCAGCAGCAGCTGCAAGG + Intergenic
1178854605 21:36239881-36239903 CTGCAGCAGCAGCAGGAGCACGG - Exonic
1178973380 21:37201008-37201030 GGGCAGCAGCAGCAGGAGTGTGG + Intronic
1180009501 21:45040319-45040341 CCACAGCAGCAGCAGCAGCATGG - Intergenic
1180863896 22:19104881-19104903 AAGCAGCAGCAGCAGCAGAGGGG + Intronic
1180962701 22:19769349-19769371 CAGCAGCAACAGCAGCAGTGTGG - Intronic
1181312977 22:21955471-21955493 GGTTGGCAGCAGTAGCAGCGGGG + Intergenic
1181346084 22:22221543-22221565 GGTTGGCAGCAGTAGCAGCGGGG + Intergenic
1181493945 22:23277510-23277532 CAGCAGCAGCAGCAGCAGCAGGG - Intronic
1181572026 22:23772920-23772942 GAGCAGCAGCAGCAGCATCGGGG - Exonic
1181725136 22:24806237-24806259 CGGCTGCAGCAGCAGCGCCGCGG + Intronic
1182123130 22:27799612-27799634 CAGCAGCAGCAGCAGCAGCATGG - Exonic
1184301546 22:43563659-43563681 CACCAGCAGCAGCAGCAGCGCGG - Intronic
1184547894 22:45184684-45184706 CGGTGGAAGCAGCAGCAACTTGG - Exonic
1184696543 22:46142654-46142676 CGGCAGAAGGAGCAGGAGCGGGG - Intergenic
1184925290 22:47632204-47632226 CAGCAGCAGCAGCAGCAGCCCGG + Intergenic
1184933727 22:47702252-47702274 CAGCAGCAGCAGCAGCGGGGTGG - Intergenic
1184933728 22:47702255-47702277 CAGCAGCAGCAGCAGCAGCGGGG - Intergenic
1185236462 22:49716420-49716442 TTGCAGCACCAGCAGCAGCGAGG - Intergenic
1185372082 22:50465631-50465653 CAGTAGCAGAAGCAGGAGCCTGG - Intronic
949105766 3:198064-198086 CCGGAGGAGCAGCAGCCGCGCGG + Intronic
950168062 3:10816337-10816359 GGGTGGCGGCTGCAGCAGCGGGG + Exonic
952055118 3:29434811-29434833 CAGCAGCAACAACAGCAGCGGGG + Exonic
952644648 3:35640087-35640109 CAGCAGCAGCAGGGGCAGCGGGG + Intronic
953063383 3:39447066-39447088 TGTTAGCAGGAGCAGCAGCTGGG + Intergenic
953766006 3:45743262-45743284 CGGTAGCATCAGCATCACCTGGG + Intronic
954304490 3:49718231-49718253 CGGCGGCAGCAGCGGCAGGGTGG + Exonic
954419870 3:50413115-50413137 TGGCAGCGGCAGCAGCAGCTGGG - Intronic
954436666 3:50499944-50499966 CGGTGACAGCAGCAGCGGCTGGG + Intronic
954912705 3:54122420-54122442 CTCTAGCAGCAGCAGCCGCCCGG - Intergenic
956193467 3:66629571-66629593 TTGCTGCAGCAGCAGCAGCGGGG + Intergenic
956193468 3:66629574-66629596 CTGCAGCAGCAGCAGCGGGGAGG + Intergenic
956780276 3:72597942-72597964 CAGCAGTAGCAGCAGCAGCAGGG + Intergenic
956813608 3:72888280-72888302 CAGCAGCGCCAGCAGCAGCGCGG - Exonic
956978978 3:74614621-74614643 CGGCAGCAGCCACAGCAGCCTGG - Intergenic
959291086 3:104475133-104475155 CAGCAGCAGCAGCAGCAGCATGG - Intergenic
959362529 3:105411443-105411465 TAGTAGCAGCAGCAGCAGCTGGG + Intronic
959530622 3:107431138-107431160 CAGTGGCAGCAGCAGAACCGGGG + Intergenic
960688145 3:120314231-120314253 CAGCAGCAGCAGCAGCATGGTGG - Intergenic
960688146 3:120314234-120314256 CTGCAGCAGCAGCAGCAGCATGG - Intergenic
961331017 3:126138016-126138038 CGCTAGCAGCAGTGGCAGTGGGG + Intronic
961856710 3:129878734-129878756 CAGCAGCAGCAGCAGCACCTGGG + Intronic
962212741 3:133492313-133492335 TGGCAGCAGCTGCAGCAGCATGG - Intergenic
962230575 3:133661994-133662016 CGGCAGCTGCAGCAGAAGAGCGG + Intergenic
962247294 3:133806154-133806176 CTGAAGCAGCGGCAGCAGCTGGG + Intronic
963038414 3:141051527-141051549 CGGTAGCAGCAGCTGGGGCCCGG - Exonic
963117020 3:141738672-141738694 CAGGAGCCGCAGCAGGAGCGTGG - Intronic
963809991 3:149766862-149766884 CAGCAGCAGCAGCAGCAGCAAGG + Intronic
963870192 3:150408301-150408323 CGGCAGCGGCGGCGGCAGCGGGG + Intergenic
965419137 3:168435513-168435535 CAGTAACAGCAGCAGCAGCAGGG + Intergenic
966448178 3:180027116-180027138 CAGCAGCAGCAGCAGCAGCAGGG + Intronic
966919803 3:184604147-184604169 GGGGCGCTGCAGCAGCAGCGAGG - Intronic
967222000 3:187255186-187255208 TGGTAGCAGCAGCAGAAGTCAGG + Intronic
967624406 3:191668343-191668365 GGGAAGCAGCAGCAGCTGCACGG + Intergenic
968137244 3:196228227-196228249 CAGGGGCAGCAGCAGCAGCAGGG - Exonic
968165359 3:196460382-196460404 AGGTAGCAGCAGCAGCTGGGAGG + Intergenic
968262120 3:197333974-197333996 CAGCAGCAGCAGCAGGAGCTAGG + Intergenic
968438731 4:610596-610618 CTGGAGTAGCAGCAGCTGCGTGG + Intergenic
968471739 4:785762-785784 AGGGAGAAGCAGCAGCCGCGTGG + Exonic
968515126 4:1012499-1012521 CGGCAGCAGGAGCAGCAACAGGG - Exonic
968542001 4:1172545-1172567 CGGCAGGAGCAGCGGGAGCGCGG + Exonic
968967850 4:3778339-3778361 CAGCTGCAGCAGCAGCAGCTGGG + Intergenic
969134475 4:5019401-5019423 CGCCAGGAGCAGCAGCAGCACGG + Exonic
969222162 4:5768074-5768096 TTGCAGCAGCAGCAGCAGTGAGG + Intronic
969402282 4:6963375-6963397 CCGGAGCAGCAGCACCAGTGTGG + Intronic
969481915 4:7451282-7451304 CAGCAGCAGCAGCGGCAGTGGGG + Intronic
969671547 4:8592841-8592863 AAGGAGCAGCAGCGGCAGCGGGG - Exonic
970180274 4:13384367-13384389 CAGCAGCAGCAGCAGCACGGTGG - Intronic
970180275 4:13384370-13384392 CAGCAGCAGCAGCAGCAGCACGG - Intronic
972083432 4:35182708-35182730 CAGCAGCAGCAGTAGCAGTGTGG - Intergenic
973306689 4:48659986-48660008 CAGCAGCAGCAGCAGCAGCAGGG + Intronic
973916078 4:55636112-55636134 CAGCAGCAGCAGCAGGAGCGGGG + Exonic
975585063 4:75940887-75940909 GGCCAGCAGCAGCAGCAGCAGGG + Exonic
976612160 4:87041328-87041350 TGATAACAGCAGCAGCAGCCTGG - Intronic
978189445 4:105895514-105895536 CGGGAGCGGCAGCAGTAGCCCGG + Exonic
978227177 4:106350916-106350938 TGCTACCAGCAGCAGCAGCTTGG - Intergenic
978964703 4:114726104-114726126 TGGTACCAGCTGCAGCAGGGAGG - Intergenic
979671717 4:123366607-123366629 CTAGAGCAGCAGCAGCAGAGAGG + Intergenic
979678065 4:123431163-123431185 AAGAAGCAGCAGCAGCAGCAGGG - Intergenic
979975472 4:127190732-127190754 CTGCAGTAGCAGCAGCAGCTGGG + Intergenic
980027119 4:127781014-127781036 CTACAGCAGCAGCAGCAGCAAGG - Intergenic
980792028 4:137632454-137632476 CAGCAGCAGCAGCAGCATGGGGG - Intergenic
980792032 4:137632457-137632479 TGCCAGCAGCAGCAGCAGCATGG - Intergenic
981511962 4:145567021-145567043 CAGCAGCAGCAGCAGCATGGCGG - Intergenic
981511963 4:145567024-145567046 CAGCAGCAGCAGCAGCAGCATGG - Intergenic
981600360 4:146481400-146481422 CAGCAGCAGCAGCAGCAGCAAGG - Intronic
981615456 4:146639365-146639387 CAGTGGCAGCAGCGGCGGCGGGG + Exonic
981760895 4:148193150-148193172 GGGTAGAAGAAGCAGCAGCAAGG - Intronic
982215602 4:153080302-153080324 CAGTAGCAGCAGCAGCAGCCAGG + Intergenic
983130438 4:164012526-164012548 TAGCAGCAGCAGCAGCAGCCAGG + Intronic
984115253 4:175671915-175671937 GGGTGGCAGCAGCTGCTGCGTGG - Intronic
984462902 4:180058765-180058787 CGGTCGCTCCAGCTGCAGCGTGG - Intergenic
985093823 4:186392093-186392115 CAGCAGCAGCAGCAGCATCTTGG + Intergenic
985241759 4:187937823-187937845 AGGAAGCAGCAGCAGGCGCGTGG - Intergenic
985279473 4:188270965-188270987 CACCAGCAGCAGCAGCAGCCTGG + Intergenic
985499168 5:230693-230715 GGGTAGCAGCACCAGTGGCGCGG + Intronic
985543581 5:498251-498273 CGGAAGCAGCAGCTCCAGGGTGG - Intronic
985580931 5:694701-694723 GGGAAGCAGGAGCCGCAGCGTGG - Intergenic
985595556 5:786033-786055 GGGAAGCAGGAGCCGCAGCGTGG - Intergenic
985685051 5:1277579-1277601 CGGTAGCTTCCGCTGCAGCGGGG + Intronic
985896304 5:2751590-2751612 CGGTGGCGGCGGCAGCAGCGCGG + Exonic
986297048 5:6448621-6448643 TGGCAGCAGCAGCAGCACCCCGG + Exonic
986456756 5:7927613-7927635 TGGCAGCATCAGCAGCAGCCAGG + Intergenic
986561408 5:9063761-9063783 AGGCAGCAGCAGCAGCAGGTGGG + Intronic
987160534 5:15137175-15137197 TGGTGGCAGCAGGAGCAGAGAGG + Intergenic
989341976 5:40386378-40386400 CAGCAACAGCAGCAGCAGCTGGG - Intergenic
989710177 5:44388612-44388634 AAGCAGCAGCAGCAGCAGCCGGG + Exonic
990165537 5:52989491-52989513 CAGCAGCAGCGGCAGCGGCGCGG - Exonic
990876687 5:60494308-60494330 CTGTAGCTGCACCAGCAGAGGGG - Intronic
991587548 5:68215782-68215804 AGGAAGCAGCGGCAGCGGCGAGG + Exonic
991927465 5:71719334-71719356 AGGTAGCATCAGCAGCAGGGCGG - Exonic
993486708 5:88495965-88495987 CGGCAGCATCAGCAGCATCTGGG - Intergenic
994099285 5:95876751-95876773 CGGCAGCAACAGCAGCACCTGGG - Intergenic
994203819 5:97009680-97009702 AAATAGCAGCAGCAGCAGCAAGG - Intronic
995026228 5:107426365-107426387 CAGTAGCAGCAGCAGCATCTGGG + Intronic
995068440 5:107889755-107889777 CTTAAGCAGCAGCAGCAGCGAGG + Intronic
995258583 5:110075256-110075278 TGCTAGCAGCAGCAGCAGCTTGG + Intergenic
996167011 5:120236611-120236633 TTCCAGCAGCAGCAGCAGCGTGG + Intergenic
996249951 5:121317365-121317387 TGCTAGCAGCAGCAGCAAGGTGG + Intergenic
996552308 5:124743863-124743885 CAGCAGCAGCAGCAGCAGCAAGG + Intronic
997239276 5:132294848-132294870 CGGTAGCGGCTGCAGCTGTGGGG - Exonic
997248345 5:132370204-132370226 CGGTAGCGGCGGCAGCTGTGGGG - Exonic
997659513 5:135578740-135578762 CAGCAGCAGCAGGAGCAGCGCGG + Exonic
997887270 5:137641412-137641434 TGGCAGCAGCAGCAGCACCTGGG - Intronic
997916572 5:137932662-137932684 CTTTATCAGCAGCAGCAGTGAGG - Intronic
997980707 5:138465944-138465966 CAGCAGCAGCAGCAGCAGCGGGG + Exonic
998774950 5:145588781-145588803 AGGCAGCACCAGCAGCAGCCAGG + Intronic
998799638 5:145856365-145856387 CAGGAGCAGCAGCAGCAGCTAGG - Intergenic
998820606 5:146054357-146054379 CAGCAGTAGCAGCAGCAGCAAGG - Intronic
998940870 5:147280615-147280637 CCACAGCAGCAGCAGCAGCAAGG + Intronic
999232186 5:150068239-150068261 CAGGAGCAGCAGCAGCAGCAAGG + Exonic
999328210 5:150656531-150656553 CGGTGGCGGCGGCAGCGGCGGGG - Intronic
1001035089 5:168291775-168291797 CGGCAGCGGCAGCGGCGGCGTGG + Intronic
1002021192 5:176365477-176365499 CGGCCGCAGCAGTCGCAGCGGGG + Exonic
1002455906 5:179345266-179345288 CAGCAGCAGCAGCAGCAGCGCGG + Exonic
1002660460 5:180788026-180788048 ATGCAGCAGCAGCAGCAGCCAGG + Intergenic
1002699751 5:181114467-181114489 GGGACGCAGCAGCAGCAGCCAGG - Intergenic
1003116062 6:3284608-3284630 CGGGTGCAGCAGCAGCTTCGAGG + Intronic
1003138937 6:3456028-3456050 CCGGAGCAACAGCAGCGGCGCGG - Exonic
1003645306 6:7909883-7909905 CGGTGGCCGCGGCAGCAGCAAGG + Intronic
1004675863 6:17841545-17841567 TGTAAGCAGCAGCAGCAGAGGGG + Intronic
1004732208 6:18368677-18368699 CAGCAGCAGCAGCGGCTGCGCGG - Intergenic
1005455688 6:26017687-26017709 CAGGAGCAGCAGAAGCGGCGGGG + Exonic
1006523989 6:34588525-34588547 TGGTACCAGCAGCAGCAGTCTGG + Exonic
1006911361 6:37565773-37565795 CGGCAGCAGCAGCCTCAGGGAGG - Intergenic
1007342578 6:41200976-41200998 CAGCAGCAGCAGCAGCAGGAAGG + Exonic
1007350748 6:41271936-41271958 GAGCAGCAGCAGCAGCAGCCAGG + Intronic
1007415915 6:41691077-41691099 CAGCAGCAACAGCAGCAGCTCGG - Exonic
1007534729 6:42576424-42576446 GGGCAGCAGCAGCAGCAGAATGG - Intronic
1007576681 6:42929617-42929639 CAGCAGCAGCAGCAGCAGCAAGG - Exonic
1007654838 6:43445762-43445784 CGGCAGCAGGAGCAGCAGCCAGG - Exonic
1007680287 6:43629051-43629073 CGGCAGCAGCAGCGGCTGCGGGG - Exonic
1007769877 6:44183959-44183981 TACCAGCAGCAGCAGCAGCGAGG + Exonic
1008469373 6:51866040-51866062 CAGCAGCAGCAGCAGCACCAGGG - Intronic
1008649075 6:53544975-53544997 CGGGAGCCGCCGCGGCAGCGCGG - Exonic
1008716396 6:54295097-54295119 CAGCAGCAGCAGCAGCAGCGGGG + Intergenic
1008716397 6:54295100-54295122 CAGCAGCAGCAGCAGCGGGGTGG + Intergenic
1008870113 6:56262813-56262835 CTGTAGCAGCATCAGCAGCCTGG + Intronic
1010124270 6:72414066-72414088 CAGTAGCACCAGCAACAGCTGGG + Intergenic
1010444483 6:75935231-75935253 CGGTAGCAGGAGCAGCTCCAGGG + Intronic
1011399929 6:86949355-86949377 CAACAGCAGCAGCAGCAGCAGGG - Intronic
1011744153 6:90393079-90393101 TAGTAGCAGCAGCAGTAGCTAGG + Intergenic
1012247165 6:96938632-96938654 CAGCAGCAGCAGCAGCAGCAGGG + Intronic
1012668917 6:102015650-102015672 CAGTAGCAGCAGCAGCACGGTGG - Intronic
1013155806 6:107490270-107490292 CGGGAGCGGCAGCGGCAGCGAGG + Exonic
1014592146 6:123286841-123286863 CAGCAGCAGCAGCAGCACCTGGG + Intronic
1014632566 6:123804062-123804084 CGCTGGCAGCAGCAGCAGCCCGG + Intergenic
1014854392 6:126381659-126381681 TGTCAGCAGCAGCAGCAGTGCGG - Intergenic
1014947692 6:127516370-127516392 CTGCAGCAGCAGCAACAGCAGGG - Exonic
1015220639 6:130801497-130801519 CGGCAGCGGCGGCAGCGGCGGGG + Intergenic
1015878916 6:137851454-137851476 CACCAGCAGCAGCAGCAGCTGGG + Intergenic
1017420599 6:154268357-154268379 GGGTAGCTGCAGCAGCACCCAGG + Intronic
1018166079 6:161098317-161098339 CAGCAGCAGCAGCAGCAGCAGGG - Exonic
1018327728 6:162691841-162691863 CTGAAGCAGCAGTAGCAGCCTGG + Intronic
1018400326 6:163414600-163414622 CGGCAGCAGCGGCGGCGGCGGGG - Intronic
1018934851 6:168267058-168267080 CCGCAGCAGCAGCAGCTGCTAGG - Intergenic
1019178638 6:170174164-170174186 CAGAAGCAGCAGAAGCAGCTAGG - Intergenic
1019447268 7:1077886-1077908 GGGAAGCAGCAGCCCCAGCGCGG + Intronic
1019450640 7:1095943-1095965 CGGCAGCAGCGGCAGCGGGGAGG + Intronic
1019484192 7:1281141-1281163 CAGCAGCAGCAGCAGCAGCCAGG + Intergenic
1019518585 7:1450468-1450490 CGGTCCCAGCAGCATCACCGTGG - Intronic
1019693880 7:2433685-2433707 GAGTAGCTGCAGCAGCTGCGCGG - Exonic
1020049471 7:5072387-5072409 CAGCAGCAGCAGCAACAGCGGGG - Exonic
1020086436 7:5313153-5313175 CAGCAGCAGCAGCAGCGGCTCGG - Exonic
1020670637 7:11104814-11104836 CAGTAGCATCAGCATCAGCTGGG - Intronic
1021131140 7:16913976-16913998 CAGTAGCAGCAGCAGCAGTGTGG - Intergenic
1021798977 7:24285142-24285164 TGGTAGCAGGAGGAGGAGCGCGG + Intronic
1022174797 7:27862721-27862743 AGGCAGCAGCAACAGAAGCGTGG - Intronic
1022459864 7:30594962-30594984 CGGCAGCAGCAGCAGCAGAGCGG - Exonic
1023405882 7:39833523-39833545 CGGTAGCGGCGGCGGCGGCGAGG + Intergenic
1023831960 7:44044698-44044720 CGGAAGCTACAGCAGCGGCGCGG + Exonic
1024607946 7:51038278-51038300 CAGGTGCTGCAGCAGCAGCGAGG + Intronic
1024674575 7:51626720-51626742 GGGAAGCAGCAGCAGGAGGGAGG - Intergenic
1025664064 7:63572914-63572936 CAGCAGCAGCAGCAGCGGCTCGG - Intergenic
1025813153 7:64888204-64888226 GGGCAGCAGCAGCAGCAGCCAGG - Intronic
1026186378 7:68084821-68084843 TGGTAGCACCAGCAGTATCGAGG - Intergenic
1026764986 7:73154820-73154842 CAGCAGCAGCAGCAGCACCGGGG + Intergenic
1026822176 7:73557255-73557277 CGGCAGCAGCCGCAGCAGGTGGG + Intronic
1026916361 7:74122249-74122271 CGGCTGCAGCAGCAGCTGCCAGG + Exonic
1027082182 7:75237792-75237814 CAACAGCAGCAGCAGCACCGGGG - Intergenic
1027628586 7:80574946-80574968 TGGCAGCTGCAGCAGCAGCAGGG + Intronic
1027859832 7:83563489-83563511 CAGCAGCAGCAGCAGCAGCTAGG + Intronic
1028962545 7:96765491-96765513 GAGCAGCAGCAGCAGCAGCTGGG - Intergenic
1029403278 7:100358325-100358347 CGGCTGCAGCAGGAGCAGCAGGG - Exonic
1029439032 7:100577300-100577322 CGGCGGCAGCAGCAGCAGAGCGG - Exonic
1029506481 7:100966478-100966500 CAGCAGCAGCACCAGCAGCGCGG - Exonic
1029547322 7:101217230-101217252 CGGCAGCAGCAGCAGGAACCGGG + Exonic
1030058909 7:105607544-105607566 CAGTAGCAGCATCAGGAGCTAGG + Exonic
1031053790 7:116972131-116972153 AGGGAGGAGCAGCAGCAGGGTGG + Intronic
1031629705 7:124032396-124032418 CAGCAGCAGCAGCAGCGGAGGGG - Exonic
1031966642 7:128031972-128031994 CGGCGGCAGCAGCAGCAGCGGGG + Intronic
1032220524 7:129990818-129990840 CGGAAGCTGCAGGAGCTGCGAGG - Intergenic
1033148025 7:138887864-138887886 CAGCAGCAGCAGCAGCAGTGAGG + Intronic
1034272145 7:149808521-149808543 CTGTAGCTGCAGCTGCAACGTGG + Intergenic
1034306362 7:150047957-150047979 GGGAGGCAGCAGCAGCAGCAAGG + Intergenic
1034331531 7:150287355-150287377 CAGCAGCAGCAGCAGCATCCTGG - Intronic
1034549158 7:151809299-151809321 CGGGTGCAGAATCAGCAGCGGGG + Intronic
1034800485 7:154052685-154052707 CAGCAGCAGCAGCAGCAGCAAGG - Intronic
1035109706 7:156470927-156470949 CGGGAGCAGGAGCAGGAGAGCGG - Intergenic
1035133463 7:156676611-156676633 TGGTAGCAGGAGCGGCAGAGAGG - Exonic
1035297474 7:157875663-157875685 CTGCAGCAGCAGCAGCACCTTGG + Intronic
1036369940 8:8154301-8154323 CGGTGGCAGCAGCAGCTGGAGGG - Intergenic
1036795941 8:11756993-11757015 CGCCACCACCAGCAGCAGCGAGG + Exonic
1036880952 8:12511329-12511351 CGGTGGCAGCAGCAGCTGGAGGG + Intergenic
1037155574 8:15694901-15694923 CGCCAGCAGCAGCAGCAGTCTGG + Intronic
1038260558 8:25989834-25989856 CAGAAGCAACAGCAGCAGCAAGG + Intronic
1038319515 8:26514220-26514242 CGGCAGCCGCGGCAGCAGCTAGG + Intergenic
1038429258 8:27486551-27486573 GGGCAGCAGCAGCAGCGGCCAGG - Intergenic
1038727611 8:30095452-30095474 CGGCGGCAGCAGCGGCAGCCGGG - Intronic
1039920158 8:41888100-41888122 CGATAGCAGGGGCAGCTGCGGGG - Intronic
1040370345 8:46764760-46764782 CAGTAGCAGCAGTAGCACCTAGG - Intergenic
1040377776 8:46843052-46843074 CTGTAGCATCATCAGCAGCTGGG - Intergenic
1041167442 8:55103172-55103194 CAGCGGCAGCAACAGCAGCGGGG + Exonic
1041232546 8:55768395-55768417 CAGCTGCAGCAGCAGCAGCAAGG - Intronic
1041869370 8:62615821-62615843 CCCTGGCAGCAGCAGCAGTGTGG - Intronic
1041871900 8:62644207-62644229 TAGTAGCAGCAGGAGCAGTGAGG - Intronic
1042444024 8:68862548-68862570 CGGCAGCAGCAGCAGCAGGTGGG - Intergenic
1042633254 8:70844319-70844341 CAATGGCAGCAGCAGCAGCAAGG - Intergenic
1042951441 8:74204227-74204249 TGGCAGCAGCTGCAGCAGCCAGG + Intergenic
1044313883 8:90727063-90727085 CAGCAGCGGCAGCAGCAGCATGG - Intronic
1044900700 8:96941174-96941196 CAGCAGCAGCAGCAGCACCAGGG - Intronic
1044923075 8:97186117-97186139 CTACAGCAGCAGCAGCAACGTGG + Intergenic
1045305228 8:100951985-100952007 CGGCGGCGGCAGCAGCGGCGAGG + Exonic
1045398855 8:101790916-101790938 CAGCAGTAGCAGCAGCAGCAAGG + Intronic
1045499398 8:102733431-102733453 CAGCAGCAGGAGCAGCAGCATGG + Intergenic
1045716541 8:105053734-105053756 AAGTAGCAGCAGCAGCAGATAGG - Intronic
1045824926 8:106386071-106386093 GGGCAGCAGCAGCAGCAGCAAGG + Intronic
1046056681 8:109086655-109086677 CAGCAGGAGCAGCAGCAGTGAGG - Exonic
1047371837 8:124262374-124262396 CGGTAGCATCAGCATCACCTGGG - Intergenic
1047418934 8:124690141-124690163 CGGGAGCAGCAGCAGTGGGGAGG - Intronic
1047418935 8:124690144-124690166 CGGCGGGAGCAGCAGCAGTGGGG - Intronic
1047493074 8:125390225-125390247 TGGCAGCGGCAGCAGCAGCGTGG - Intergenic
1047836914 8:128703804-128703826 CTGCAGCAGCAGCAGCAACTTGG - Intergenic
1047961804 8:130016514-130016536 CAGCAGCAGCAGCAGCAGCCCGG + Intronic
1048274468 8:133055852-133055874 CAGCAGCAGCAGCAGCAGCAGGG + Intronic
1048472925 8:134719441-134719463 GCCCAGCAGCAGCAGCAGCGAGG + Intergenic
1048575001 8:135683343-135683365 CGGGACCGGCAGCAGCAGCAGGG - Intergenic
1048752629 8:137697379-137697401 CAGCAGCAGCAGCAGCAGCAGGG + Intergenic
1048980906 8:139703132-139703154 CAGCAGCAGCAGCAGCAGCGGGG + Intergenic
1048980907 8:139703135-139703157 CAGCAGCAGCAGCAGCGGGGAGG + Intergenic
1049025916 8:139988757-139988779 CGTCAGCACCAGGAGCAGCGAGG - Exonic
1049345800 8:142137921-142137943 CGTAAGCAGCAGCAGCAGTAGGG - Intergenic
1049409027 8:142464242-142464264 CAGCAGCAGCAGTAGCAGCGGGG - Exonic
1049681550 8:143920813-143920835 CTCTACCAGCAGCTGCAGCGAGG - Exonic
1049802581 8:144524936-144524958 CAGCAGCAGCGGCAGCAGTGCGG + Exonic
1049823907 8:144654853-144654875 CGGTTGCAGCAGCACCTGGGAGG - Intergenic
1049923773 9:389605-389627 CAGCAGCAGCAGCAGCACCCAGG + Intronic
1050733242 9:8733808-8733830 GAGGAGCAGCAGCAGCAGCCTGG + Exonic
1051222870 9:14868924-14868946 CAGGAGGAGCAGCAGCAGCACGG + Exonic
1051973066 9:22914156-22914178 CAGCAGCAGCAGCAGCAGCCTGG + Intergenic
1052143405 9:25017690-25017712 CAATAGCAGCAGCAGCACCCGGG + Intergenic
1053329498 9:37190210-37190232 CAGTGACAGCAGCAGCAGTGGGG - Intronic
1053511271 9:38689739-38689761 CGGCAGCAGCAGCAACAGCAGGG - Intergenic
1053542847 9:38993161-38993183 CAGCAGCAGCAGTGGCAGCGAGG + Intergenic
1053807293 9:41816678-41816700 CAGCAGCAGCAGTGGCAGCGAGG + Intergenic
1054623299 9:67370749-67370771 CAGCAGCAGCAGTGGCAGCGAGG - Intergenic
1054716635 9:68563535-68563557 CGGCAGCAGCAGCATCAGCTGGG + Intergenic
1054738477 9:68780233-68780255 CGGTGGCAGCGGCGGCGGCGGGG + Exonic
1054782032 9:69174313-69174335 CAGGAGCAGAAGCAGAAGCGGGG + Intronic
1055154043 9:73038872-73038894 CCATAGCAGCAGCAGCAGGCAGG - Intronic
1055840773 9:80500456-80500478 CAGCAGCAGCAGCAGCAGTACGG - Intergenic
1056180198 9:84075622-84075644 CAGCAACAGCAGCAGCAGCAGGG - Intergenic
1056902316 9:90611563-90611585 GGCTTGCAGCAGCAGCAGTGTGG - Exonic
1057222061 9:93262785-93262807 GGGAAGCAGCAGCAGGAGCCAGG - Intronic
1057490368 9:95515930-95515952 CGGGAGCAGCCGCAGCCGCAGGG - Intronic
1057869700 9:98708657-98708679 CAGTAGCAGTAGCAGGCGCGCGG + Exonic
1057908915 9:99003454-99003476 ATTTAGCAGCAACAGCAGCGGGG + Exonic
1058560863 9:106227527-106227549 AGGTAGCAGCTGCAGCATTGTGG + Intergenic
1060970885 9:127737198-127737220 GGGTCACAGCAGCAGCAGAGTGG - Intergenic
1061015691 9:127979956-127979978 CGGTCGCGCCTGCAGCAGCGGGG - Intronic
1061293681 9:129666089-129666111 CGGGGGCAGCAGCGGCAGCGAGG + Exonic
1061396379 9:130346079-130346101 CGGTAGCAGCAGAAGGCGGGTGG + Intronic
1062084622 9:134642249-134642271 CAGCAGCAGCAGCAGCAGCGGGG - Exonic
1062403703 9:136383539-136383561 CAGCAGCAGCAGCAGCAGCGAGG - Exonic
1062542108 9:137046062-137046084 CGGGAGCAGCGGAGGCAGCGGGG + Exonic
1203665418 Un_KI270754v1:18134-18156 CGGCGGCAGCAGGAGCATCGCGG - Intergenic
1203666565 Un_KI270754v1:23770-23792 CGGCGGCAGCAGGAGCATCGCGG - Intergenic
1203667714 Un_KI270754v1:29409-29431 CGGCGGCAGCAGGAGCATCGCGG - Intergenic
1203668859 Un_KI270754v1:35051-35073 CGGCGGCAGCAGGAGCATCGCGG - Intergenic
1203669706 Un_KI270754v1:39274-39296 CGGCGGCAGCAGGAGCATCGCGG - Intergenic
1186470343 X:9816579-9816601 CAGCAGCAGCAGCAGCAGCAGGG - Intronic
1186495091 X:10006749-10006771 CTGAAGCAGCAGCAGGAGCCTGG + Intergenic
1186880084 X:13856382-13856404 CAGCAGCAGCAGCAGCATCTGGG + Intronic
1187274851 X:17808232-17808254 CAGCAGCAGCAGCAGCACCCAGG + Intronic
1187311792 X:18151574-18151596 CTGTAGCAGCAGCTACAGCAAGG - Intergenic
1187856052 X:23637039-23637061 TGGTGGCAGCAGCAGCAGCTGGG - Intergenic
1188833923 X:34933242-34933264 TGCCAGCAGCAGCAGCAGTGTGG - Intergenic
1189104316 X:38220748-38220770 CGGCAGCAGCAGCAGCAGCGCGG + Exonic
1189211929 X:39290980-39291002 CAGCAGCATCAGCAGCAGCTGGG - Intergenic
1189318570 X:40073500-40073522 CAGTAGCAGCACCAGCAGCAAGG - Exonic
1189558047 X:42165718-42165740 CAGTGGCAGCAGCAGCACGGTGG + Intergenic
1189992818 X:46610626-46610648 CAGCAGCAGCAGCAGGACCGAGG + Intronic
1190237924 X:48631671-48631693 CAGCAGCAGCAGCAGCAGCAGGG - Intergenic
1190459643 X:50659481-50659503 CGCTAGCATCAGCAGAAGAGTGG + Intronic
1191128186 X:56980618-56980640 GGGCAGCAGCAGTAGCAGCGTGG + Intronic
1192034132 X:67545399-67545421 AGGCAGCAGCAGCAGCAGCAGGG + Exonic
1192952276 X:76029591-76029613 GTGTGGCAGCGGCAGCAGCGGGG + Intergenic
1194265177 X:91744228-91744250 TGGCAGCAGCAGCAGCTGCATGG - Intergenic
1194425393 X:93731340-93731362 CAGCAGCAGCAGCAGCACCCTGG - Intergenic
1196047370 X:111270388-111270410 CAGCAGCAGCAGCAGCAGCAGGG - Exonic
1196214622 X:113035924-113035946 CAGTGGCGGCAGCAGCAGCTTGG - Intergenic
1196679239 X:118453963-118453985 CTGGAGAAGCAGCAGCAGCTGGG + Intergenic
1196723316 X:118875001-118875023 CGCAAGCAGCAGCAGAAGTGAGG + Intergenic
1196744312 X:119055834-119055856 GGAAAGCAGCAGCAGCAGCAAGG + Intergenic
1197141559 X:123122467-123122489 TGTCAGCAGCAGCAGCAGCTTGG - Intergenic
1197894589 X:131298415-131298437 CAATAGCAGTAGCAGCAGCAGGG + Intronic
1198044944 X:132892325-132892347 CAGTAGCAGCAGCAGCACCTTGG + Intronic
1199612713 X:149631682-149631704 CAGTAGCGGGAGCAGCAGCGTGG - Exonic
1199769388 X:150964684-150964706 CAGTGGCAGCAGCAACAGCAAGG + Intergenic
1200110073 X:153736541-153736563 CTGCAGCAGCAGCAGGGGCGGGG - Intronic
1200582329 Y:4964674-4964696 TGGCAGCAGCAGCAGCTGCATGG - Intergenic
1201142969 Y:11043706-11043728 CGGCAGCAGCAGTAGCACCTTGG - Intergenic