ID: 947119124

View in Genome Browser
Species Human (GRCh38)
Location 2:226798689-226798711
Sequence TTCTCGGACGTGCGCAAGGT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 28
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 25}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947119124_947119129 -5 Left 947119124 2:226798689-226798711 CCCACCTTGCGCACGTCCGAGAA 0: 1
1: 0
2: 0
3: 2
4: 25
Right 947119129 2:226798707-226798729 GAGAAGCCATCGCTCTCCGGAGG 0: 1
1: 0
2: 0
3: 7
4: 54
947119124_947119130 -4 Left 947119124 2:226798689-226798711 CCCACCTTGCGCACGTCCGAGAA 0: 1
1: 0
2: 0
3: 2
4: 25
Right 947119130 2:226798708-226798730 AGAAGCCATCGCTCTCCGGAGGG 0: 1
1: 0
2: 0
3: 2
4: 70
947119124_947119127 -8 Left 947119124 2:226798689-226798711 CCCACCTTGCGCACGTCCGAGAA 0: 1
1: 0
2: 0
3: 2
4: 25
Right 947119127 2:226798704-226798726 TCCGAGAAGCCATCGCTCTCCGG 0: 1
1: 0
2: 0
3: 3
4: 52

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947119124 Original CRISPR TTCTCGGACGTGCGCAAGGT GGG (reversed) Exonic
1070772147 10:79088705-79088727 TTCTGGGACTTGGGGAAGGTGGG + Intronic
1133212492 16:4271419-4271441 TTCTACGGCGTGCGCAAGTTTGG - Intronic
1134923094 16:18134847-18134869 TTCTCAGACATGCTGAAGGTAGG + Intergenic
1139778217 16:69330359-69330381 TTCTCGCACGTGTGCCAAGTCGG - Exonic
1141926444 16:87173411-87173433 TTCTCCTACGTGAGCAGGGTGGG + Intronic
1144433786 17:15221043-15221065 TTCTCAGAAGTGCCCAAGGATGG + Intergenic
1152405405 17:80095434-80095456 ATCAGGGACGTTCGCAAGGTAGG + Exonic
1160915702 19:1495590-1495612 TTCTACTACGTGGGCAAGGTGGG + Exonic
1160942015 19:1624692-1624714 CTCACGGACGTGCGCACAGTGGG + Intronic
1162184963 19:8897661-8897683 TTCTCAGACCTGGGGAAGGTAGG + Exonic
1162185824 19:8904020-8904042 TTCTCGGACCTGAGGAAGGTAGG + Exonic
1162186198 19:8906834-8906856 TTCTCGGACCTGAGGAAGGTAGG + Exonic
1162186541 19:8909473-8909495 TTCTCAGACCTGGGGAAGGTAGG + Exonic
935013062 2:99154212-99154234 ATCTCTAACGTGGGCAAGGTGGG - Intronic
935903291 2:107815478-107815500 TTCTCGGATGTGAGCATGCTTGG - Intergenic
947119124 2:226798689-226798711 TTCTCGGACGTGCGCAAGGTGGG - Exonic
1181338140 22:22156917-22156939 TTCTCAGAGGTGAGCAAGGCCGG + Intergenic
955878503 3:63519580-63519602 TTCTCTGACATCCTCAAGGTTGG + Intronic
987707341 5:21473227-21473249 TTCACAGACTTGTGCAAGGTTGG - Intergenic
999769073 5:154761443-154761465 TTCTGGGAGGTGGGCAGGGTGGG + Intronic
1004720366 6:18263926-18263948 TTCTCGGACGCGGGCTGGGTGGG + Exonic
1009020882 6:57947272-57947294 TTCACAGACTTGTGCAAGGTTGG + Intergenic
1026989081 7:74573061-74573083 TTCCCCGACGTGTGGAAGGTTGG - Intronic
1035620212 8:1030907-1030929 TTCTGAGAAGGGCGCAAGGTCGG + Intergenic
1035737738 8:1901026-1901048 TTCTCGGAGGGGAGCAGGGTGGG + Intronic
1057384258 9:94593569-94593591 TCCTCGGCTGTGCGCAAGGCCGG - Exonic
1061779555 9:132987592-132987614 TTCCCGGATGTGGGCTAGGTGGG + Intronic
1200162953 X:154018672-154018694 TTCTCGGAGGAGCTCAAGATCGG - Exonic