ID: 947119758

View in Genome Browser
Species Human (GRCh38)
Location 2:226801308-226801330
Sequence CTTGCACTGCAGAGGGAAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 361
Summary {0: 1, 1: 0, 2: 2, 3: 40, 4: 318}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947119752_947119758 11 Left 947119752 2:226801274-226801296 CCTGCTGATTGGTGGGATGGCCT 0: 1
1: 0
2: 0
3: 10
4: 82
Right 947119758 2:226801308-226801330 CTTGCACTGCAGAGGGAAGGTGG 0: 1
1: 0
2: 2
3: 40
4: 318
947119747_947119758 21 Left 947119747 2:226801264-226801286 CCCGGGGAGGCCTGCTGATTGGT 0: 1
1: 0
2: 0
3: 7
4: 122
Right 947119758 2:226801308-226801330 CTTGCACTGCAGAGGGAAGGTGG 0: 1
1: 0
2: 2
3: 40
4: 318
947119748_947119758 20 Left 947119748 2:226801265-226801287 CCGGGGAGGCCTGCTGATTGGTG 0: 1
1: 0
2: 0
3: 17
4: 187
Right 947119758 2:226801308-226801330 CTTGCACTGCAGAGGGAAGGTGG 0: 1
1: 0
2: 2
3: 40
4: 318
947119753_947119758 -9 Left 947119753 2:226801294-226801316 CCTGTTTTTCAAGCCTTGCACTG 0: 1
1: 0
2: 1
3: 11
4: 154
Right 947119758 2:226801308-226801330 CTTGCACTGCAGAGGGAAGGTGG 0: 1
1: 0
2: 2
3: 40
4: 318

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947119758 Original CRISPR CTTGCACTGCAGAGGGAAGG TGG Intergenic
900469693 1:2847633-2847655 CCGGCACTGCAGAGGGAAGGAGG + Intergenic
900767146 1:4513182-4513204 TTAGCCCTGCAGAGGGGAGGAGG + Intergenic
901692379 1:10981890-10981912 CTTGCATCTAAGAGGGAAGGGGG - Intronic
902744596 1:18465037-18465059 CTTGCACTGCAGAGGAGTGATGG + Intergenic
903651768 1:24926939-24926961 CTTGAGCAGCAGAAGGAAGGCGG - Intronic
904066371 1:27755011-27755033 GCTGAACTGCAGAGGTAAGGTGG - Intronic
904215342 1:28914559-28914581 CTCGCCTCGCAGAGGGAAGGCGG + Intronic
904592025 1:31620219-31620241 CCTGCACCCCAGAGGGCAGGGGG + Intronic
905304312 1:37007003-37007025 CTTGCACAGCAGAGGGAAGACGG - Intronic
905471592 1:38196278-38196300 CCTGCATTCCAGCGGGAAGGGGG + Intergenic
905829125 1:41050125-41050147 CTGGCACTGCAGTGGGGAAGGGG + Intronic
906257999 1:44365383-44365405 CTCTCACTGCAGCTGGAAGGAGG - Intergenic
907454428 1:54566057-54566079 CTGGCTCTCCAGAGGGAAGGGGG - Intronic
907987460 1:59546402-59546424 CTTGCTCTGCAGAGGGTGGGAGG + Intronic
908532823 1:65049798-65049820 CTTGCAATGCTAAGAGAAGGAGG - Intergenic
912624179 1:111194251-111194273 CTTGCAAGGCTGAGGGAGGGTGG - Intronic
912935275 1:113998484-113998506 AATGAACTGCAGAGGGAAAGAGG + Intergenic
915225457 1:154407882-154407904 CTTGCATTGCAGTAGGAAGAGGG - Intronic
915356145 1:155256030-155256052 GTGGCACAGCAGAGGGAAGCTGG + Exonic
916086649 1:161275094-161275116 CTGGCAGGGCAGAGGGAAAGTGG + Intronic
917736094 1:177921585-177921607 CTGGCAGTGCTGAGAGAAGGGGG + Intergenic
918046503 1:180944770-180944792 ATTGCACAGCAGAGGGACAGTGG - Intronic
919737740 1:200963826-200963848 CTTAGACTGCAGAGTGAAAGAGG + Intergenic
919978163 1:202626241-202626263 ATGCCACTGCAGAGGGAGGGTGG - Intronic
922007831 1:221550424-221550446 GTTGCCCTGCAGAGAGAAGTTGG + Intergenic
922769942 1:228176318-228176340 CTCACACTTCAGTGGGAAGGGGG - Exonic
922844204 1:228670302-228670324 CTAGCTCTGCTGAGGAAAGGGGG - Intergenic
923002184 1:230016209-230016231 CTTGCAGTGCATAGGAAAGCTGG + Intergenic
923386769 1:233472706-233472728 CTTTCACTGTGCAGGGAAGGAGG + Intergenic
924428348 1:243974429-243974451 CTCGCTTTGGAGAGGGAAGGAGG + Intergenic
1062885349 10:1011824-1011846 CGCGCACTGCAGAGGGGAAGAGG - Intronic
1063768436 10:9169492-9169514 CCTTCATTGAAGAGGGAAGGAGG + Intergenic
1064462677 10:15550436-15550458 CCTGCCCTTCAGAGGGAAGAGGG + Intronic
1064873542 10:19966849-19966871 CCTGCAATGCAGAGGCCAGGGGG + Intronic
1067293455 10:44960610-44960632 CTGGCACGGCGGAGGGAGGGAGG + Intronic
1067448507 10:46367418-46367440 CTGGCACTGCAGAGGCCTGGGGG - Intergenic
1067588867 10:47493347-47493369 CTGGCACTGCAGAGGCCTGGGGG + Intergenic
1067635993 10:48001438-48001460 CTGGCACTGCAGAGGCCTGGGGG + Intergenic
1069312066 10:67050559-67050581 CTCGAGCTACAGAGGGAAGGTGG - Intronic
1069886192 10:71625245-71625267 CCTGCACTGCAGAGTGAACGGGG + Intronic
1070132557 10:73665446-73665468 CTGGCACTGCAGAGGCCTGGGGG + Intergenic
1071353558 10:84770280-84770302 CTAGAACTGCAGAGGTAAGCAGG + Intergenic
1071609126 10:87018629-87018651 CTGGCACTGCAGAGGCCTGGGGG - Intergenic
1071979550 10:90989569-90989591 GTTGCTCTGCAGAGGGGAGGAGG - Intergenic
1074350507 10:112732428-112732450 CTTGCACTGCACAGAGAATGGGG - Intronic
1074669037 10:115766649-115766671 TTTCCACTGTAGAGGGAAGGCGG + Intronic
1075806306 10:125191332-125191354 CTTGCTGTGCAGATGGAAGGAGG + Intergenic
1076222420 10:128745300-128745322 AGAGCACTGCAGAGGGATGGTGG + Intergenic
1076721393 10:132394965-132394987 CGGGCAGGGCAGAGGGAAGGTGG + Intergenic
1076722669 10:132399496-132399518 CTTGCAAAGCAGAGGGGAGAGGG + Intronic
1076976963 11:180276-180298 CTGGCACTTCAGCGGGAAGTTGG + Intronic
1077254186 11:1573115-1573137 CTCGCGCTGCAGGGGGAGGGCGG + Intergenic
1077533049 11:3106210-3106232 CTTGCTCTGCACAGGGACAGAGG - Intronic
1078815176 11:14813730-14813752 CTTTCACTGAAAAGGGAAAGAGG + Intronic
1079604088 11:22343586-22343608 CAGCCACAGCAGAGGGAAGGAGG - Intronic
1083638120 11:64131165-64131187 CAGGCACTGCAGAGGGAAATGGG + Intronic
1085534933 11:77212041-77212063 CCTGCCCTGGTGAGGGAAGGAGG + Intronic
1086949531 11:92877353-92877375 CTGGTTGTGCAGAGGGAAGGTGG - Intronic
1087802651 11:102520373-102520395 CTTCCACCCAAGAGGGAAGGTGG - Intergenic
1089179953 11:116576620-116576642 CCAGCACTGCAGAGGGCAGGGGG + Intergenic
1089343692 11:117776842-117776864 CCTGCACTGAAGAGGGGATGAGG + Exonic
1089666761 11:120025600-120025622 CTTGCACTCTACAGGGATGGGGG + Intergenic
1090063505 11:123484131-123484153 GGTGCACAGCACAGGGAAGGTGG - Intergenic
1090074422 11:123571022-123571044 GGCGCACTGCAGAGGGAAGCAGG + Intronic
1090208324 11:124897850-124897872 CTCACAGTGAAGAGGGAAGGAGG + Exonic
1090938650 11:131368258-131368280 AGTGCAGTGCAGAAGGAAGGTGG - Intergenic
1090990830 11:131815585-131815607 TGTGCTCTGCAGAGGAAAGGGGG + Intronic
1090991170 11:131818142-131818164 GATGCACTGCAGCGTGAAGGTGG - Intronic
1091674805 12:2481435-2481457 GTTGCACCCCAGAGGGAATGCGG + Intronic
1092731420 12:11538596-11538618 CAGGCACTGCAGAGGGGAGCCGG - Intergenic
1095261497 12:40104842-40104864 CTAGCAGTGGAGAGGCAAGGTGG + Intronic
1096867364 12:54572720-54572742 CTTGCTCCGCACAGGGATGGTGG + Exonic
1097170754 12:57111327-57111349 CTTACACTGAAGAGGGAGGACGG - Exonic
1097396986 12:59087268-59087290 CAGGCACTGCAGACAGAAGGGGG - Intergenic
1097942494 12:65326981-65327003 AAAGCACTGCAGAGGGCAGGGGG - Intronic
1098359802 12:69643244-69643266 TTTGGTCTGCAGTGGGAAGGTGG - Intergenic
1098713589 12:73800601-73800623 CTGGTACTGCAGAGAGTAGGCGG + Intergenic
1102655804 12:114481333-114481355 CTGGCGCTGCAGAGGGAGGAAGG + Intergenic
1106175755 13:27329810-27329832 CGTGGACTGCAGAGTGAAGGGGG + Intergenic
1109344429 13:61098348-61098370 CTTGCACTGCAGGAGAAAGAGGG - Intergenic
1113671652 13:112179617-112179639 CTGATACTGCAGAAGGAAGGGGG + Intergenic
1114266989 14:21078427-21078449 ACGGCACTGCAGAGGGATGGGGG + Exonic
1115430315 14:33309898-33309920 CTGGCCCTGCAGAGGGAGGAGGG + Intronic
1116684473 14:48019790-48019812 CTTACATTTCAGAGGCAAGGTGG - Intergenic
1116934662 14:50726790-50726812 GGTGGACTGCAGAGGGATGGGGG - Intronic
1117965107 14:61198972-61198994 CTTGCAAGGCTGAGGGATGGGGG + Intronic
1118731361 14:68669350-68669372 CGTGCTCTGGAGAGGGAAGCAGG - Intronic
1118906572 14:70027881-70027903 CCTGCAGAGCAGAGGGATGGAGG - Intronic
1119165314 14:72487614-72487636 CTGGCTTTGCAGATGGAAGGGGG + Intronic
1119940337 14:78633952-78633974 CTTCCCCTGCAGGGGGAGGGAGG - Intronic
1121179915 14:91921278-91921300 CTTGCACCTGAGAGGGAAGAAGG - Intronic
1121268630 14:92622538-92622560 CATGCAAGGCAGAGGCAAGGGGG + Intronic
1122374775 14:101250538-101250560 CTTGCATTGCAGACAGAAGGCGG - Intergenic
1122661924 14:103301760-103301782 CCTGCATTGCAGAGCTAAGGGGG + Intergenic
1122813755 14:104302036-104302058 CTCCCACTGCAGAGAGAATGAGG - Intergenic
1123018766 14:105387795-105387817 CTGGCTCGGCAGAGGGCAGGTGG + Intronic
1124021347 15:25927421-25927443 CTCACACTGAGGAGGGAAGGAGG - Intergenic
1125594154 15:40873737-40873759 CTTGCACTGCAGGGGCGGGGCGG + Exonic
1125886023 15:43230171-43230193 CTTTGACTGCAGAGTGAAGTGGG - Intergenic
1125968808 15:43895371-43895393 TTTGCTCTGCAGAGGGACAGAGG - Intronic
1126416225 15:48420410-48420432 CTAGCAGTGCAGCGGGAGGGTGG + Intronic
1126907582 15:53384465-53384487 CTTACACGGCTCAGGGAAGGAGG + Intergenic
1127812159 15:62573677-62573699 CATGCACTAGGGAGGGAAGGGGG - Intronic
1128350196 15:66883336-66883358 CTTTCACTCCAGAGGGAGTGGGG + Intergenic
1128352728 15:66901875-66901897 CTTGAGCTGCAGAAGGAAGCAGG - Intergenic
1128775855 15:70319807-70319829 CCAGCATGGCAGAGGGAAGGAGG - Intergenic
1129109232 15:73328046-73328068 CGTGGCCTGGAGAGGGAAGGTGG + Intronic
1129692544 15:77721927-77721949 CTGGCTCTGCAGCGGGAAGAGGG - Intronic
1129948632 15:79564121-79564143 CTTGTACTGAACAGGGAATGGGG - Intergenic
1129960276 15:79678342-79678364 CATGCAATGCAGAGGGCATGGGG + Intergenic
1130042687 15:80418329-80418351 CTTGCACTGCCCTGGGAAGAAGG + Intronic
1130253980 15:82317302-82317324 CTTGGGCTGCAGAGGGCATGGGG - Intergenic
1130867187 15:87943015-87943037 ATTACAATGCAGAGGAAAGGTGG - Intronic
1131395837 15:92085210-92085232 GTTGCCCTTCAGAGGGCAGGTGG - Intronic
1133967429 16:10541624-10541646 CTTGCAGAGCTCAGGGAAGGAGG + Intronic
1135843289 16:25895715-25895737 CTCACACAGCAGAGGGAAAGAGG + Intronic
1137882263 16:52062381-52062403 CTGGCAATGCAGATGGAAGAAGG - Intronic
1138390543 16:56667454-56667476 CTGGCTCTGCACAGAGAAGGGGG - Intronic
1139288029 16:65832828-65832850 CATGCTCTGCTCAGGGAAGGTGG + Intergenic
1139341290 16:66269836-66269858 CCTGCACTGCACAGGAAAGCAGG + Intergenic
1139655189 16:68383181-68383203 CTTGCTCTGCACAGTGTAGGTGG - Intronic
1139959870 16:70711295-70711317 CATGCCCTCCTGAGGGAAGGAGG + Intronic
1140208235 16:72950673-72950695 CTTGCAGTGCAGCTGGAAGTTGG + Exonic
1141163558 16:81645274-81645296 ATGGCACTGCAGAGTGGAGGAGG - Intronic
1141873314 16:86804541-86804563 CTGGCAAGGCAGAGGCAAGGTGG + Intergenic
1142443297 16:90116394-90116416 CTGGCACTTCAGCGGGAAGTTGG - Intergenic
1142889367 17:2933017-2933039 CTTGCTTGGCAGAGGGGAGGAGG + Intronic
1143327103 17:6106589-6106611 GTTGCTCTGGGGAGGGAAGGAGG + Intronic
1143916196 17:10295180-10295202 CTAGAAGAGCAGAGGGAAGGAGG - Intergenic
1144633607 17:16889012-16889034 CTTCCTCTGCAGCTGGAAGGGGG + Intergenic
1146627466 17:34445340-34445362 CTTGGACTGCAGAGGGTGGAGGG - Intergenic
1146644778 17:34569896-34569918 CTTGGCCTGGGGAGGGAAGGGGG + Intergenic
1148741045 17:49892875-49892897 TTTACACAGCACAGGGAAGGGGG + Intergenic
1148853653 17:50566989-50567011 CTTTCCCTGCAGAGGAGAGGAGG + Intronic
1149306127 17:55348272-55348294 CTTGCACTGTTGAGGCAAGTGGG + Intergenic
1149500664 17:57149978-57150000 CTAGCACTACAGTGGGAGGGAGG - Intergenic
1149503385 17:57172372-57172394 ATTTAACTGCAGAGGGAAGAGGG + Intergenic
1150249429 17:63698007-63698029 CTTGCCCTGCAGAGGCAGGGTGG + Exonic
1151315257 17:73317899-73317921 TTTTCCCTGCAGAGGGAAGGAGG - Intergenic
1151828514 17:76536845-76536867 CGTGCCCTCCAGCGGGAAGGGGG + Intronic
1151941054 17:77292225-77292247 CGGGGACTGCAGAGGGTAGGTGG - Intronic
1152022732 17:77789315-77789337 CGGGCTCTGCAGAGGGAAGAAGG - Intergenic
1154499452 18:14987975-14987997 CCTGCAGGGCAGAGGGGAGGTGG + Intergenic
1156154670 18:34287675-34287697 CTAGCAATGCTGTGGGAAGGGGG - Intergenic
1156413220 18:36857081-36857103 CTTGCACTGCTAAGGCAAGGAGG + Intronic
1157244112 18:46038561-46038583 CTAGCACTGTTGAAGGAAGGAGG + Intronic
1157804287 18:50646538-50646560 GTGGAACTGCAGAGGGACGGGGG + Intronic
1158381947 18:56941467-56941489 CTTGAATTGCAGAGGGAACCAGG + Intronic
1158760867 18:60385086-60385108 CCTTCACTGGAGAGAGAAGGTGG + Intergenic
1159025667 18:63180468-63180490 CTTCCCCTGGAGAGAGAAGGTGG + Intronic
1161056031 19:2190995-2191017 CTTCCACTGCGGACGGAGGGTGG - Exonic
1161720610 19:5900194-5900216 GTTTCCCTTCAGAGGGAAGGGGG - Intronic
1162496334 19:11025197-11025219 CTGGCACAGCAGAGGGCAGATGG - Intronic
1163493350 19:17630283-17630305 CTGGAACTGCAGGGGGAAGGAGG + Exonic
1163541801 19:17915900-17915922 CTTTCTCTGGAGAGGGAAGAGGG - Intergenic
1164401640 19:27906000-27906022 CATGCAGTCCAGTGGGAAGGAGG - Intergenic
1164902959 19:31943597-31943619 CCAGCCCGGCAGAGGGAAGGTGG + Intergenic
1165062711 19:33212634-33212656 GGAGCACTGCGGAGGGAAGGCGG + Exonic
1166384438 19:42372475-42372497 CTGGGACTGGAGAGAGAAGGTGG - Intronic
1166454395 19:42928698-42928720 CTCCCTCTGCAGAGGGCAGGTGG + Intronic
1166835322 19:45664183-45664205 CCTGGAGTGGAGAGGGAAGGGGG - Intergenic
925427993 2:3766987-3767009 CGTCCACTGCAGAGGGCATGTGG - Intronic
925851774 2:8088708-8088730 CTAGCATTCCAGAGGGAAGGAGG + Intergenic
925910358 2:8569759-8569781 CATGCACTGCAGAGGGGACACGG - Intergenic
926024066 2:9524504-9524526 TTTCGACTGCAGAGGGAAGAAGG + Intronic
926347116 2:11957563-11957585 CTTGCAGTACAGAGGGAGGCTGG + Intergenic
926365392 2:12128510-12128532 GATGCATTGCATAGGGAAGGTGG + Intergenic
927443342 2:23135694-23135716 CTTGCACTGCAGATCGAGAGAGG + Intergenic
927707268 2:25304149-25304171 CTTCCAGCGCAGAGGGGAGGGGG + Intronic
929554962 2:42920487-42920509 CATGCCAAGCAGAGGGAAGGAGG - Intergenic
929603554 2:43219822-43219844 CTGGCACGGCTGAGGGAGGGAGG - Intergenic
929787721 2:45004259-45004281 CTGGCACTCCAGAGAGGAGGGGG + Intergenic
930514882 2:52393854-52393876 CTTGCTCTGCAAAGGGACTGAGG - Intergenic
932575139 2:72958702-72958724 GTAGCCCTGAAGAGGGAAGGCGG - Intronic
932634449 2:73376160-73376182 CTTACATGGCAGAGGGAGGGAGG - Intergenic
932674553 2:73767836-73767858 AATACACTGCAGAGGGAAAGAGG - Intronic
933587912 2:84200229-84200251 GTTCCACTGCTGAGAGAAGGTGG + Intergenic
935673382 2:105574125-105574147 CCTGCAGAGCAGAGGGAAGGTGG - Intergenic
936060617 2:109293474-109293496 CTGGCAGTGGAGAGAGAAGGGGG - Intronic
936065093 2:109325132-109325154 CGAGCACTGCAGAGGAAATGTGG - Intronic
938077590 2:128348024-128348046 TTTGCAGTGCAGAGGTAAAGAGG + Intergenic
938248463 2:129796476-129796498 CCTTCACTGCAGTGGGAAGCTGG - Intergenic
938498656 2:131818343-131818365 CCTGCAGGGCAGAGGGGAGGTGG + Intergenic
938949650 2:136244586-136244608 CTTACAAGGCACAGGGAAGGAGG + Intergenic
940843080 2:158607505-158607527 CTAGGACTGCAGAGGCAAAGGGG + Intronic
943190611 2:184673551-184673573 ATTGCACTGCAGCAGGAAAGAGG + Intronic
946619884 2:221549512-221549534 TTTTCACTGCAGAGTGAATGTGG - Intronic
946879014 2:224159147-224159169 CTGGCACTGCAGTAGGAAAGTGG - Intergenic
946997606 2:225412823-225412845 CCTGCACTGCAGAGGCACAGAGG + Intronic
947119758 2:226801308-226801330 CTTGCACTGCAGAGGGAAGGTGG + Intergenic
948306986 2:236955666-236955688 TTTGCAGAGCAGAGGGAACGGGG - Intergenic
948630333 2:239298389-239298411 CTTGCACCTCAGAGGGAAACAGG + Intronic
948894148 2:240920518-240920540 CCTGCACAGCAGAGGAAAGCAGG + Intronic
948976374 2:241466223-241466245 CTTGCACTGTAGGGGGACAGGGG - Intronic
1169179471 20:3550783-3550805 CTTTCCCCCCAGAGGGAAGGGGG - Intronic
1169250397 20:4056370-4056392 CTACCACTGAAGAGGGAAGAGGG - Intergenic
1169312833 20:4561684-4561706 CTTGCACTTGAGAGGGTAGGGGG - Intergenic
1170035823 20:11988584-11988606 CTTATACTGTAGAGAGAAGGAGG - Intergenic
1171142299 20:22753815-22753837 GTGGGACTGCAGAGGGAAGGAGG + Intergenic
1172787556 20:37479198-37479220 TTTGCACGGCAGAGTGAAGGAGG - Intergenic
1172798222 20:37558072-37558094 GTTTCACTGGAGAGGGTAGGTGG + Intergenic
1172898720 20:38318690-38318712 CTTGCAGAGCTGAGGGAATGAGG - Intronic
1173814466 20:45976324-45976346 CTTCCACTGTAGAGAGGAGGCGG + Intergenic
1174311445 20:49658569-49658591 TTTGCAGTGCAGAGGAAAGGAGG - Intronic
1174492787 20:50913763-50913785 CTTGGCCTACAGAGGGAAGCTGG + Intronic
1174523710 20:51154967-51154989 ACTGCACTGCAGATGGTAGGTGG + Intergenic
1176081403 20:63275084-63275106 CCTGCACTGCGTTGGGAAGGTGG + Intronic
1176703124 21:10082573-10082595 CCTACACTGCAGAGGGTAGAGGG + Intergenic
1177385024 21:20397298-20397320 CTTTCAGTGCAGAGGGGAGTTGG + Intergenic
1177820595 21:26027158-26027180 CTTGCACTGATGAGGGAAGAGGG + Intronic
1178792516 21:35713323-35713345 CTGGCACTGCAGTTGGAAGAAGG - Intronic
1179088406 21:38241312-38241334 ACTCCACTGCAGAGGGAGGGTGG - Intronic
1179146153 21:38769678-38769700 CCTGAACTGCACAGGGTAGGTGG - Intergenic
1179419767 21:41226052-41226074 CTTGCACTGGAGAGGGGAAATGG - Intronic
1179659319 21:42864451-42864473 CATGCCCTGCAGAGGGATGGAGG + Intronic
1179822111 21:43942988-43943010 TTTCCACAGCAGAGGGAGGGAGG + Intronic
1179942330 21:44648273-44648295 CTAGCACTGGAGAGTGAAGAGGG + Intronic
1180023863 21:45147537-45147559 CTTAGACTGGAGAGAGAAGGGGG + Intronic
1181422379 22:22810789-22810811 GATGCTCTCCAGAGGGAAGGGGG + Intronic
1182130541 22:27847087-27847109 CTTGCACTCCAGACTGAGGGAGG - Intergenic
1182376248 22:29850530-29850552 CTTGCATGGCAGAAGGAAGAAGG + Intergenic
1183198207 22:36367856-36367878 CTTGGACTGGGGAGGGGAGGAGG - Intronic
1183255003 22:36756512-36756534 CTTGCCCCGCCAAGGGAAGGAGG - Intergenic
1183992633 22:41608577-41608599 CCTGCAGGGCAGAGTGAAGGGGG + Intronic
1184558189 22:45244975-45244997 CTGGCACTGAAGAGGGAGGAAGG + Intergenic
1184616021 22:45639367-45639389 CTTGCAGTGCCAAGGGGAGGAGG - Intergenic
949889566 3:8723755-8723777 CTGGCTCTGCAGAGGTGAGGAGG - Intronic
950202010 3:11051035-11051057 CTTGCGCTACAGAGGGGTGGGGG + Intergenic
950262771 3:11554425-11554447 CTTGCCTTCCAGAGGGCAGGTGG + Intronic
950425909 3:12924652-12924674 CTTGCGCTGCAGCAGGAAGTGGG + Exonic
950698895 3:14726412-14726434 CATCCACTGCAGAGGGAGGCCGG + Intronic
950897843 3:16469612-16469634 CGTGCTCCACAGAGGGAAGGGGG + Intronic
951368259 3:21812399-21812421 CTTGCACTTCTGAGGTGAGGCGG - Intronic
953673296 3:44980572-44980594 CTTTCACTGCAGCAGGAAGGTGG - Intronic
953850169 3:46459924-46459946 CATGAAATGGAGAGGGAAGGAGG - Intronic
954127389 3:48539522-48539544 TTTGCTTTCCAGAGGGAAGGGGG - Intronic
954592960 3:51799694-51799716 CCTGCAATGCAGAGGGAAGATGG + Intergenic
954923993 3:54216616-54216638 CTTGCCCTCCAGCTGGAAGGTGG + Intronic
959540680 3:107534322-107534344 CATGGACTGCAGAGGGAATGTGG + Intronic
960080627 3:113536402-113536424 GTTGCACTGAAGAGGGGAGGTGG - Intronic
961708018 3:128804369-128804391 CTAGCACTGCAAAAGGAAAGGGG - Intronic
962734927 3:138317292-138317314 CTTGCAGTGCTGAGGCCAGGAGG + Intronic
962873731 3:139519755-139519777 GTTGGACTTCAGAGGCAAGGTGG + Intronic
963865793 3:150359669-150359691 CTTGCACTCCAGAGGTGAGCTGG + Intergenic
964078077 3:152716327-152716349 CCTGCAGTACAGAGGGACGGTGG - Intergenic
964991513 3:162818638-162818660 TCTGCAGTGCAAAGGGAAGGAGG + Intergenic
966424668 3:179768232-179768254 GTTTGGCTGCAGAGGGAAGGCGG + Intronic
967613906 3:191542023-191542045 ATTGCACTGCAAAGTGAAGAGGG - Intergenic
967857603 3:194130005-194130027 CTTGCACTGCAAACTGGAGGTGG - Intergenic
967888658 3:194349717-194349739 CTTGCACTGGACTGGGAGGGTGG - Intronic
968817245 4:2828443-2828465 CTGGGACCCCAGAGGGAAGGAGG - Intronic
970200458 4:13599639-13599661 CTTGCCCTGCAGAGGGCTTGTGG + Exonic
970454181 4:16205620-16205642 CATGCACACCACAGGGAAGGAGG + Intronic
970697951 4:18699532-18699554 TTTGCACTGCAATGGGCAGGGGG - Intergenic
972305549 4:37826697-37826719 CTACCGCTGCAGAGGGAAGCAGG - Exonic
972618186 4:40720691-40720713 CTTAAACTGTAAAGGGAAGGAGG - Intergenic
973719094 4:53705372-53705394 GTTCCTGTGCAGAGGGAAGGAGG + Intronic
973808637 4:54549031-54549053 CTGGGACAGCCGAGGGAAGGGGG + Intergenic
974752855 4:66164014-66164036 CATGCACTGCTCAGTGAAGGTGG - Intergenic
976078077 4:81321632-81321654 CGTCCACTGCGGTGGGAAGGAGG + Intergenic
977768383 4:100827982-100828004 ACTGCAATGCAGAGTGAAGGAGG - Intronic
977786601 4:101042342-101042364 TTTTCAGGGCAGAGGGAAGGTGG - Intronic
980375326 4:131938940-131938962 CCTACACTGCAGAGGGTAGAGGG + Intergenic
980848588 4:138354027-138354049 GTTAGACTGCAGAGAGAAGGTGG - Intergenic
985245714 4:187977866-187977888 CTTGCACTGGGGAGGGGAAGTGG - Intergenic
985791652 5:1931373-1931395 CCTCACCTGCAGAGGGAAGGCGG - Intergenic
986190467 5:5492219-5492241 CTTTCAGTGCAGAGGTAAGCAGG + Intergenic
986487640 5:8255191-8255213 CTAGCACTGCAGGAGGAATGTGG + Intergenic
987970005 5:24930345-24930367 CTTGCCCTCCAGAGACAAGGTGG + Intergenic
988461237 5:31439834-31439856 GATGCACTGAGGAGGGAAGGAGG + Intronic
989316567 5:40087119-40087141 ATTGAACTGCAGTGTGAAGGGGG - Intergenic
993575336 5:89592534-89592556 CTTGCTCTGCAGAGGGAAATAGG - Intergenic
994467545 5:100157553-100157575 CTTCCACTGCAGAAGTAAAGTGG + Intergenic
996823940 5:127660293-127660315 CTTGCTCTGGACAAGGAAGGAGG - Intergenic
999264058 5:150255170-150255192 CCTGCACTGGAGGAGGAAGGAGG - Intronic
999388640 5:151173992-151174014 ACAGCACTGCAGGGGGAAGGTGG + Intergenic
999451875 5:151684785-151684807 CTTTAACTGTAGAGGGAATGGGG + Intronic
1002357669 5:178643927-178643949 CTGCCACTGTAGAGGGAAAGCGG - Intergenic
1004460246 6:15828500-15828522 CCTGGACTACAGAGGGCAGGCGG + Intergenic
1004808680 6:19234161-19234183 CTTAATCTGCAGAGGGAAGGGGG + Intergenic
1005724370 6:28634533-28634555 CTTGCAATGAAGTGTGAAGGTGG + Intergenic
1007075685 6:39064771-39064793 CAGGCCCTGCAGAGGCAAGGCGG - Intronic
1007664973 6:43508689-43508711 ATCGAAATGCAGAGGGAAGGGGG - Intronic
1007904739 6:45448286-45448308 CTTGCTCTGCAGAGGTCATGTGG + Intronic
1011746613 6:90413123-90413145 CATGCACTGCAGTGGGTAGCTGG - Intergenic
1013077370 6:106783184-106783206 TTTGCGCTGAAGAGGGAAGAGGG + Intergenic
1013300283 6:108798864-108798886 GTTGCACTGCAGAATGAGGGAGG + Intergenic
1014828661 6:126075844-126075866 GTTGCAAAGGAGAGGGAAGGTGG + Intergenic
1015123518 6:129727152-129727174 TGTGCACAGCAGAGGAAAGGGGG - Intergenic
1015844127 6:137500638-137500660 TTTGCAGGGCAGAGGGGAGGAGG + Intergenic
1017279607 6:152609169-152609191 CTTGCACTTCCGAGGTGAGGCGG - Intronic
1017503341 6:155045690-155045712 CAACCACTGCAGAGGCAAGGAGG - Intronic
1017744765 6:157436567-157436589 CTTGAACTGCTGGGGGAGGGGGG + Intronic
1018174924 6:161170189-161170211 CTTGCAGTCCACAGGGCAGGCGG - Intronic
1018650688 6:165989015-165989037 GATGCACTGCGCAGGGAAGGAGG + Intergenic
1019252087 7:20901-20923 CTGGCACTTCAGCGGGAAGTTGG + Intergenic
1020093950 7:5357271-5357293 CTTTAGCTGGAGAGGGAAGGTGG + Exonic
1022047948 7:26638343-26638365 CGAGAAGTGCAGAGGGAAGGAGG - Intronic
1022248803 7:28586478-28586500 CTTCAGCTGGAGAGGGAAGGGGG - Intronic
1022671841 7:32463082-32463104 GTTGCTGTGGAGAGGGAAGGAGG - Intergenic
1024117453 7:46207429-46207451 CCTGCACTGCCGCGGGGAGGGGG + Intergenic
1024698556 7:51882447-51882469 CTTGCAGAGCTGAGGGAAAGGGG - Intergenic
1026457414 7:70584738-70584760 CTTGCTCTGAAGAAGGAAGGGGG + Intronic
1029177953 7:98678274-98678296 CTGGCATTGCAGAGGGAAGAAGG + Intergenic
1029507249 7:100969779-100969801 CTTGCCATGCAAAGGGGAGGAGG - Intronic
1030050567 7:105533350-105533372 CTTGGACTGGACAGGAAAGGGGG + Intronic
1030050719 7:105534765-105534787 CTTGCACTGAACAGGAAAGGGGG + Intronic
1030130144 7:106193008-106193030 CTCTCACTCCAGGGGGAAGGTGG - Intergenic
1030756401 7:113292095-113292117 CTTGCAATGCAGTGAGCAGGGGG - Intergenic
1030906490 7:115189872-115189894 CTAGCAGTGGAGAGGGTAGGTGG + Intergenic
1031223417 7:119002633-119002655 ATTGCACTGCAGAGACAAGGCGG - Intergenic
1031870985 7:127090094-127090116 CTTGGACTGGAGTGGGAATGAGG - Intronic
1032116144 7:129118876-129118898 CTTGAAGGGCAGAGGGAAGTGGG - Intergenic
1032715651 7:134506969-134506991 GGTGGACTGCAGAGGGAAGCTGG + Intergenic
1033772088 7:144564011-144564033 CTGGCACTGCTGAGGGAAGAAGG + Intronic
1037758308 8:21725765-21725787 CTTGCACTGCAGAGAGACCTGGG - Intronic
1037803183 8:22045984-22046006 CTTGTCCTGCAGAGTGAAGTGGG - Intronic
1038550736 8:28466346-28466368 CTATCACTGCAGTGGGGAGGAGG + Intronic
1039532452 8:38275754-38275776 CTTCCAGTGCAGAGGGAACCAGG + Exonic
1039663020 8:39487748-39487770 CTTGTTCTGCAGAAGGAAGGGGG - Intergenic
1040563672 8:48546722-48546744 CTTGCATTCTAGTGGGAAGGGGG - Intergenic
1041775622 8:61519739-61519761 CTGGCTCTGAAGATGGAAGGGGG + Intronic
1042331820 8:67588466-67588488 CTTGCAATAGAGAAGGAAGGAGG + Intronic
1044380809 8:91530960-91530982 ATTGTACAGCAGAGGGAAGGGGG + Intergenic
1044866262 8:96574046-96574068 CTAGCTATGCAGAGGGGAGGGGG - Intronic
1046615277 8:116470693-116470715 CTTGCTCTTCAGAGGCAAGCTGG - Intergenic
1047363481 8:124191084-124191106 CTTGGGCTACAGAGGAAAGGTGG + Intergenic
1047511768 8:125521091-125521113 CTTTGCCTGAAGAGGGAAGGAGG + Intergenic
1049298169 8:141854902-141854924 CTTGTCCTGCACAGGGAAGGAGG + Intergenic
1051244260 9:15093233-15093255 CTGGCTTTGAAGAGGGAAGGAGG - Intergenic
1052641228 9:31167628-31167650 CCTGCTCTGCAGAGGGAAGCAGG - Intergenic
1052824424 9:33164851-33164873 TCTGCACAGCAGAGTGAAGGGGG - Intronic
1053302806 9:36963804-36963826 CTTGTGCTGCAGAGGCCAGGTGG + Intronic
1053585664 9:39455970-39455992 CTAGGGCTGCAGAGGGCAGGGGG + Intergenic
1053640383 9:40069606-40069628 CCTACACTGCAGAGGGTAGAGGG + Intergenic
1053765752 9:41395867-41395889 CCTACACTGCAGAGGGTAGAGGG - Intergenic
1054321078 9:63665602-63665624 CCTACACTGCAGAGGGTAGAGGG + Intergenic
1054544365 9:66307020-66307042 CCTACACTGCAGAGGGTAGAGGG - Intergenic
1054580647 9:66909255-66909277 CTAGGGCTGCAGAGGGCAGGGGG - Intronic
1054928806 9:70615367-70615389 TTTGTTCTGCAGAGGGAAGGGGG - Intronic
1056265809 9:84895761-84895783 CTTCCACTGCAGAAGTGAGGTGG - Intronic
1056446956 9:86675556-86675578 GATCCACTGCAGAGGCAAGGGGG - Intergenic
1056558270 9:87707393-87707415 TTTGGACTGCAGAAGCAAGGGGG + Exonic
1056771653 9:89481915-89481937 ATCTCACTGCAGAAGGAAGGAGG + Intronic
1056919280 9:90771947-90771969 CAGGCACTGAAGAGGGAAGTGGG + Intergenic
1058206509 9:102115403-102115425 CTTGCACTGCTGAAGGAAGCTGG + Intergenic
1058804351 9:108576848-108576870 CAAGTGCTGCAGAGGGAAGGTGG - Intergenic
1059138648 9:111831424-111831446 CATGAACTGCATAGGGAAAGAGG - Intergenic
1059430553 9:114247660-114247682 CTTGGACAGTAGCGGGAAGGAGG + Intronic
1061240086 9:129365013-129365035 TTTTCACAGCAGAGGGAAGAAGG + Intergenic
1061321763 9:129835384-129835406 ATTGGACGGCAGAGGGAAGGAGG + Intronic
1062277857 9:135739146-135739168 CTAGCACTGCACTGGGCAGGGGG + Intronic
1062748254 9:138231014-138231036 CTGGCACTTCAGCGGGAAGTTGG - Intergenic
1202788153 9_KI270719v1_random:52679-52701 CCTACACTGCAGAGGGTAGAGGG + Intergenic
1185790694 X:2926913-2926935 CTTGAACTGCAGTGGATAGGTGG + Intronic
1187346773 X:18472729-18472751 CTTGCACTGCAGAAGACAGAAGG - Intronic
1188744896 X:33829810-33829832 CATCCACTCCAGTGGGAAGGGGG - Intergenic
1192315805 X:70050381-70050403 ATTGGAGGGCAGAGGGAAGGAGG + Intergenic
1195413071 X:104589913-104589935 CTTACACTGAAGAAGGCAGGAGG + Intronic
1199866327 X:151853209-151853231 CTTGAGCTTCAGAGGGCAGGAGG + Intergenic
1199975081 X:152890005-152890027 CTTGGATGGCAGAGGGAATGAGG + Intergenic