ID: 947120327

View in Genome Browser
Species Human (GRCh38)
Location 2:226807633-226807655
Sequence CAGTGGGAGCAGAGTGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947120320_947120327 26 Left 947120320 2:226807584-226807606 CCTGACTGGAGGGCATTTGGCAC 0: 1
1: 0
2: 1
3: 67
4: 411
Right 947120327 2:226807633-226807655 CAGTGGGAGCAGAGTGAGGAAGG No data
947120318_947120327 28 Left 947120318 2:226807582-226807604 CCCCTGACTGGAGGGCATTTGGC 0: 1
1: 0
2: 1
3: 19
4: 159
Right 947120327 2:226807633-226807655 CAGTGGGAGCAGAGTGAGGAAGG No data
947120319_947120327 27 Left 947120319 2:226807583-226807605 CCCTGACTGGAGGGCATTTGGCA 0: 1
1: 0
2: 1
3: 21
4: 210
Right 947120327 2:226807633-226807655 CAGTGGGAGCAGAGTGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947120327 Original CRISPR CAGTGGGAGCAGAGTGAGGA AGG Intergenic
No off target data available for this crispr