ID: 947120868

View in Genome Browser
Species Human (GRCh38)
Location 2:226813387-226813409
Sequence TGTTAGATAGATCACTCTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947120864_947120868 15 Left 947120864 2:226813349-226813371 CCATTGAATCAGGACAATGCCAC No data
Right 947120868 2:226813387-226813409 TGTTAGATAGATCACTCTTGTGG No data
947120862_947120868 28 Left 947120862 2:226813336-226813358 CCAGCAGTGGGAGCCATTGAATC No data
Right 947120868 2:226813387-226813409 TGTTAGATAGATCACTCTTGTGG No data
947120867_947120868 -4 Left 947120867 2:226813368-226813390 CCACACAGTTGGGCTTTCATGTT No data
Right 947120868 2:226813387-226813409 TGTTAGATAGATCACTCTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947120868 Original CRISPR TGTTAGATAGATCACTCTTG TGG Intergenic
No off target data available for this crispr