ID: 947121588

View in Genome Browser
Species Human (GRCh38)
Location 2:226820973-226820995
Sequence AACCTTCCCTCTGTTCCTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947121584_947121588 27 Left 947121584 2:226820923-226820945 CCTGTAACTGGGCCAGGAAGATG No data
Right 947121588 2:226820973-226820995 AACCTTCCCTCTGTTCCTCCAGG No data
947121587_947121588 -8 Left 947121587 2:226820958-226820980 CCGTGGCATCAGTCAAACCTTCC No data
Right 947121588 2:226820973-226820995 AACCTTCCCTCTGTTCCTCCAGG No data
947121585_947121588 15 Left 947121585 2:226820935-226820957 CCAGGAAGATGAGCAAACAGCAT No data
Right 947121588 2:226820973-226820995 AACCTTCCCTCTGTTCCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947121588 Original CRISPR AACCTTCCCTCTGTTCCTCC AGG Intergenic
No off target data available for this crispr