ID: 947123810

View in Genome Browser
Species Human (GRCh38)
Location 2:226845577-226845599
Sequence CAGAATATAAAGAAGTTGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 351
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 326}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947123810_947123812 29 Left 947123810 2:226845577-226845599 CCTGACAACTTCTTTATATTCTG 0: 1
1: 0
2: 1
3: 23
4: 326
Right 947123812 2:226845629-226845651 CATCTTGTGCTTCTGTTTGTTGG 0: 1
1: 0
2: 2
3: 12
4: 262
947123810_947123813 30 Left 947123810 2:226845577-226845599 CCTGACAACTTCTTTATATTCTG 0: 1
1: 0
2: 1
3: 23
4: 326
Right 947123813 2:226845630-226845652 ATCTTGTGCTTCTGTTTGTTGGG 0: 1
1: 0
2: 0
3: 35
4: 455

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947123810 Original CRISPR CAGAATATAAAGAAGTTGTC AGG (reversed) Intronic
901699372 1:11036207-11036229 CAGAAACTAAAGAAGTCGCCGGG + Intronic
902773340 1:18659209-18659231 CAGAATAAAATGTAGTTGACTGG - Intronic
903635706 1:24813713-24813735 AAGAAAATAAATAAATTGTCCGG - Intronic
903917853 1:26777532-26777554 AAAAAAATAAAGAAGTTATCCGG - Intronic
903979695 1:27176901-27176923 AAGAAGATGAAGAAGTTTTCAGG + Intergenic
904475950 1:30764667-30764689 CAAAAGATAAAAAAGTTGGCCGG - Intergenic
905298749 1:36971813-36971835 CAGAAGAAAAGGAAGGTGTCAGG - Intronic
906411037 1:45579733-45579755 CAAAATATAAATAAGTGGACTGG - Intergenic
908049048 1:60207737-60207759 CAGAATAAAAAAAAATAGTCTGG - Intergenic
908419016 1:63941389-63941411 AAGGATATATAGGAGTTGTCTGG + Intronic
910053211 1:83000870-83000892 AAGAATTTAAATAAGTTGTCAGG + Intergenic
910106844 1:83640893-83640915 CAAAATATAAAGAGGTTATGTGG + Intergenic
910501033 1:87890876-87890898 AAGAATATATAGAAGCTGGCTGG + Intergenic
911138620 1:94471394-94471416 CAAAATATAAAAAAGTTAGCTGG + Intronic
912145935 1:106794579-106794601 CAGAATATAATGAAGCTTTTGGG - Intergenic
913011641 1:114689301-114689323 CAGCATATCACCAAGTTGTCTGG - Intronic
916366343 1:164032330-164032352 AAGAATATAATGAGGTTGGCTGG - Intergenic
916431699 1:164736170-164736192 CAGATTGTAATGAAGTAGTCAGG - Intronic
916488592 1:165281025-165281047 CAGAACATGGAGAAGTAGTCTGG + Intronic
917590967 1:176476540-176476562 GAGAGTATAAAGAATCTGTCTGG + Intronic
917951886 1:180046990-180047012 CAGAATATAATGCAATTGTTTGG - Intronic
918670774 1:187212698-187212720 CAGAATATAAAGAAGAAGAAAGG + Intergenic
920697655 1:208193724-208193746 CAAAATATAAAAAATTTGTCTGG + Intronic
921083903 1:211769221-211769243 CAGGATGAAAAGAAGTGGTCAGG + Intronic
924051271 1:240081814-240081836 CAAAATATAAAAAATTAGTCAGG + Intronic
924451815 1:244185240-244185262 CAGAATATACAGAACTTGGTTGG + Intergenic
924662204 1:246031435-246031457 CAGATTAAAAAGAAGTTATGGGG + Intronic
1063684165 10:8220544-8220566 CAAAATATAAAAAAGTTAGCTGG + Intergenic
1064760350 10:18612625-18612647 CAGAATCTAAAGTAGTAGTTAGG - Intronic
1065411986 10:25439481-25439503 CTGAAAATATAGCAGTTGTCTGG + Intronic
1066167422 10:32802232-32802254 CGGAATGTAAAGAAGTTGGTTGG - Intronic
1067453481 10:46397027-46397049 CAGAAGAGAAAGAGCTTGTCAGG + Intergenic
1067583750 10:47462719-47462741 CAGAAGAGAAAGAGCTTGTCAGG - Intronic
1067592435 10:47524735-47524757 CAGATTTTACAGAAGTTGTTGGG + Intronic
1067633754 10:47988067-47988089 CAGAAGAGAAAGAGCTTGTCAGG - Intergenic
1067639551 10:48032808-48032830 CAGATTTTACAGAAGTTGTTGGG + Intergenic
1068352112 10:55861490-55861512 GTGAATATAAAGAACTTGTTGGG + Intergenic
1068603937 10:58985094-58985116 CAAAATCTCAAAAAGTTGTCAGG + Intergenic
1068702401 10:60033903-60033925 CAGTTTATATAGAAGTTTTCGGG + Intronic
1068787800 10:60995982-60996004 GAGAATAAAATGAAGTTGTTTGG - Intronic
1070093777 10:73315725-73315747 CAAAAAATAAAAAAGTTGTCTGG - Intronic
1071384956 10:85110495-85110517 AAGAATATAAAGATGGTGTTAGG + Intergenic
1071571076 10:86697515-86697537 AAGAAAAAAAAGAAGTTGGCCGG - Intronic
1072181059 10:92980349-92980371 TAGTATGTAGAGAAGTTGTCTGG + Intronic
1072641400 10:97213761-97213783 CAGAATATAAAGAACAGCTCTGG + Intronic
1073169264 10:101489290-101489312 CAGACTATTAAAGAGTTGTCTGG - Intronic
1073241556 10:102062154-102062176 TAGAATATAAAAAAGTAGGCAGG + Intergenic
1075345012 10:121675531-121675553 CAGAGAGTAAACAAGTTGTCAGG - Intergenic
1076145361 10:128114706-128114728 CAGAAGAGATGGAAGTTGTCAGG - Intronic
1077626314 11:3774921-3774943 CAGAAAATGAAGAATTTGTCAGG - Intronic
1081280903 11:41208608-41208630 CAGAATAAAAGAAAGCTGTCAGG + Intronic
1086559507 11:88151495-88151517 CAGAATAAAAAGGCTTTGTCTGG - Intronic
1087687846 11:101285568-101285590 CAGTATAGAGAGAAGTTGGCTGG - Intergenic
1087945965 11:104160951-104160973 TAGTATATCAAGAAGTTGTGGGG + Intronic
1088247785 11:107835954-107835976 AAGAATAAAGACAAGTTGTCTGG + Intronic
1088613017 11:111597064-111597086 CAGAATAGAATGATGTTGCCTGG + Intergenic
1092484688 12:8892445-8892467 AAAAATACAAAAAAGTTGTCTGG - Intergenic
1092815498 12:12309313-12309335 CAGAAAATAAAAAATTTGCCAGG + Intergenic
1093709625 12:22315136-22315158 GAGAATATAAAGAAAGTGTAAGG - Intronic
1094038710 12:26099841-26099863 CAAAATGTAATGAAGTAGTCAGG - Intergenic
1094216405 12:27947410-27947432 CAGGATATAAACAAGTAGGCAGG + Intergenic
1094279773 12:28723205-28723227 CAGGAGATATAGAAGATGTCAGG - Intergenic
1094766387 12:33599930-33599952 CAAAATATAAAGAAGTAGGGGGG + Intergenic
1095674268 12:44898049-44898071 CAGAATCTAAAGTGGTAGTCTGG - Intronic
1095691076 12:45089377-45089399 CAGAAGAAAAAGGAGTTTTCAGG - Intergenic
1095768369 12:45922478-45922500 AAGAATATAAAGAAATTGTACGG - Exonic
1097557453 12:61156869-61156891 CAGGCTATAAAGAAATTATCTGG - Intergenic
1098430032 12:70408920-70408942 GAGAATACAGAGAAGTTTTCTGG - Intronic
1100155888 12:91799872-91799894 CAGAATACAAAGAGTTTGTTTGG + Intergenic
1100539696 12:95546625-95546647 CAGATTCTAATGGAGTTGTCTGG - Intronic
1100560765 12:95747463-95747485 CAAAAAATAAAGAAGTTAGCTGG - Intronic
1100619952 12:96261516-96261538 TAGAATAGAAAGAAATTGTTTGG + Intronic
1101368484 12:104100414-104100436 CAAAAAATAAAGAAGTTTTCTGG + Intronic
1102209624 12:111116328-111116350 CAGAATATTGAGAAGTGGTGAGG + Intronic
1103647272 12:122404240-122404262 CAGAATATAAAGCAGGGGCCTGG + Intronic
1103659971 12:122506397-122506419 CATAATATGTAGAAGATGTCAGG + Intronic
1105066313 12:133201947-133201969 CTGAATATAAATAAATTCTCAGG - Intronic
1105946056 13:25190733-25190755 AAGGATATAAAGATGTTGTCTGG - Intergenic
1106029025 13:25982445-25982467 CAGAATACAACCAATTTGTCCGG - Intronic
1106523819 13:30522272-30522294 CAAAAAATAAAGAAGTTAGCTGG - Intronic
1106593449 13:31117514-31117536 CACAATAAAAATAAGTTGACTGG + Intergenic
1106786188 13:33110108-33110130 CAGAAGCTGAAGAGGTTGTCTGG + Intronic
1107441515 13:40431719-40431741 CAGCATTTAAAACAGTTGTCTGG + Intergenic
1107669457 13:42729310-42729332 CAGAATTAAAATAAGTTTTCTGG - Intergenic
1107969914 13:45631466-45631488 TAGAATATAAAGAAATGGTCAGG - Intergenic
1108536025 13:51379991-51380013 CAGATTATAAATAAGCTCTCTGG + Intronic
1108962744 13:56256400-56256422 CAGAAGATAAAGTAGGTGGCAGG - Intergenic
1109144395 13:58759609-58759631 CAAAATATAAATCAGTAGTCTGG + Intergenic
1109480626 13:62947082-62947104 GAGAATATGAAAAAGTTGTGTGG - Intergenic
1109844894 13:67975887-67975909 GATAATTTAAAGAAGTTTTCTGG + Intergenic
1110153355 13:72282605-72282627 CTGGATTTAAAGACGTTGTCAGG + Intergenic
1110527691 13:76558183-76558205 CAAAATACAAAAAATTTGTCAGG + Intergenic
1110896636 13:80760975-80760997 CAGAATCTAAAGAACATGTAAGG - Intergenic
1111111008 13:83709422-83709444 AAGAATATAAAATAGTAGTCAGG + Intergenic
1111440714 13:88280227-88280249 AGGAATATAATGAAGTTGGCTGG + Intergenic
1112349997 13:98625021-98625043 GAAAATATACAGAAGTTGACCGG + Intergenic
1112459095 13:99587420-99587442 TAGAAAACAAAGAAATTGTCTGG - Intergenic
1113216098 13:108042392-108042414 CAGAATATAAAGAACTTGGAGGG - Intergenic
1114337383 14:21705172-21705194 AAGAATAAAAAGATGTAGTCTGG + Intergenic
1115975199 14:38989490-38989512 CAGAATCTACAGAAACTGTCAGG + Intergenic
1116674573 14:47889049-47889071 CAGAAAATAATCAAGTTGTTAGG + Intergenic
1117125126 14:52614646-52614668 CAAAATATAAAAAATTAGTCGGG - Intronic
1118081922 14:62371202-62371224 CAGAATGTAAACAAGATGGCAGG - Intergenic
1118236209 14:64007713-64007735 CAAAATATAAAAAAATTGGCCGG + Intronic
1119143342 14:72287752-72287774 CTCAATATAAAAAAGTTGGCTGG - Intronic
1120524439 14:85561437-85561459 CAGAATAAAATTAAGTTGACTGG - Intronic
1121212606 14:92220138-92220160 AAAAATATAAAAAAATTGTCTGG - Intergenic
1127301819 15:57662583-57662605 CAGAATGTATAGAAGGTGCCTGG + Intronic
1127324386 15:57881075-57881097 AAGAACATAAAGAAGTTGAAAGG - Intergenic
1130846521 15:87752708-87752730 CAGAATATAATTATGTGGTCAGG + Intergenic
1130886139 15:88094168-88094190 AAGAATAAAAAGAAGTCGGCCGG + Intronic
1130970960 15:88731997-88732019 CAAAAAATAAAGAAATTATCTGG + Intergenic
1131875877 15:96806001-96806023 CAGAACATAAATGATTTGTCAGG + Intergenic
1132436830 15:101813104-101813126 GTGGATATAAAGAAGTTGTCAGG - Intronic
1133691080 16:8215984-8216006 CAGCATATAAAATTGTTGTCCGG + Intergenic
1134194387 16:12147873-12147895 CAAAATAAAAAGAAGTTGCTTGG - Intronic
1134425526 16:14140200-14140222 ATGAAAATAAAGAAGTAGTCTGG - Intronic
1136469603 16:30470835-30470857 CAAAAAATAAAAAAGTAGTCAGG + Intergenic
1137962434 16:52896239-52896261 CAGAATTTAAAGAAATTTGCTGG - Intergenic
1137975759 16:53030522-53030544 CAGAAGACAAAGAAGATGACTGG + Intergenic
1142301324 16:89260106-89260128 CAAAAAATAAAAAAGTTGGCTGG + Intergenic
1143206347 17:5142892-5142914 TAGAATACAAAGAAGTAGGCTGG + Intronic
1148269122 17:46249963-46249985 AAAAATATAAAGAACTAGTCGGG - Intergenic
1149168086 17:53778147-53778169 CAGAAAATATAGAAGATATCAGG - Intergenic
1149839551 17:59947402-59947424 GAGAAGAAACAGAAGTTGTCTGG - Exonic
1149873896 17:60210601-60210623 TAGAATACAAAGAAGTAGGCTGG - Intronic
1149891797 17:60396236-60396258 CAGAAAATAAAAAATTAGTCAGG - Intronic
1150063896 17:62092456-62092478 CAAAAAATAAAGAAGTCGGCGGG + Intergenic
1150087674 17:62287862-62287884 TAGAATACAAAGAAGTAGGCTGG - Intergenic
1150590779 17:66560247-66560269 AAAAATATGAAGAAATTGTCAGG + Intronic
1152694994 17:81739700-81739722 CAAAATATAAAAAATTAGTCGGG - Intergenic
1153839811 18:8996623-8996645 CAGAAAATACAAAAATTGTCTGG - Intergenic
1153973698 18:10248258-10248280 CTGAAGAAAAAGAAGTTGGCTGG + Intergenic
1155628193 18:27860700-27860722 GAGAAGAAGAAGAAGTTGTCTGG - Intergenic
1156096836 18:33543837-33543859 AAGAATAGAAAGAAGTGGTTTGG + Intergenic
1157155313 18:45259817-45259839 AAGAATATAAAGGAGTAATCTGG + Intronic
1157344993 18:46820554-46820576 CAGAATATATTGATGTTGTTTGG - Intronic
1157845554 18:51000802-51000824 AGGAATATAATGAAGTTGGCTGG + Intronic
1159697362 18:71576663-71576685 CAGATTATAAAGAGCTTGTAAGG - Intergenic
1161642972 19:5435831-5435853 GAGAATAAAAAGAAGCTGTGGGG - Intergenic
1162330138 19:10023020-10023042 AAGAATATACAAAAGTTGGCCGG - Intergenic
1162331106 19:10030437-10030459 TAGAAAGTAAAGAAGTTGTTCGG + Intergenic
1162393392 19:10403117-10403139 CAGACTATGAAGAAGTTCTAGGG + Intronic
1164761799 19:30733675-30733697 CAGAAGAGAAAGAAGTTTTGGGG - Intergenic
1165002538 19:32776845-32776867 CAGAAAATAAAGATATTTTCAGG + Intronic
1165024188 19:32947649-32947671 CAGAATACAAAAAAGTAGCCAGG - Intronic
1165426227 19:35746843-35746865 CAGTATGTGCAGAAGTTGTCAGG - Exonic
1165490092 19:36118397-36118419 AAGAATAAAAAGAATTGGTCGGG + Intronic
1168112571 19:54201877-54201899 CAGAATATAAAGATATAGACGGG - Intronic
926175898 2:10591840-10591862 CAAAATATAAAAAATTAGTCAGG + Intronic
926632703 2:15151490-15151512 GAGAATTTAAAGAAGTTTGCTGG - Intergenic
926715865 2:15922990-15923012 AAGAAAAAAAAGAAGGTGTCAGG - Intergenic
928006764 2:27569335-27569357 CAGAATATAAAGAAACTGTGGGG + Intergenic
928423911 2:31162213-31162235 CAGAAGTGACAGAAGTTGTCTGG + Intergenic
928632405 2:33207266-33207288 CATAAACTAAAGTAGTTGTCTGG + Intronic
928667078 2:33560243-33560265 CAGAAAATAAATTAGTTGGCTGG - Intronic
929638698 2:43552941-43552963 CAGAAAATAAACTAGTTGCCTGG + Intronic
931969725 2:67572797-67572819 CAGAATACAGACAAATTGTCAGG + Intergenic
932154805 2:69406731-69406753 CAGAAAATAAAAAAATTGCCTGG - Intronic
934029991 2:88035484-88035506 TAGAATAAAAAGAAAATGTCTGG + Intronic
935426315 2:102921808-102921830 GAGAACACAAAGGAGTTGTCAGG - Intergenic
935831580 2:107006262-107006284 TTGAAAATAAAGAAGTAGTCAGG - Intergenic
935938535 2:108213917-108213939 CAGAATATAAAATTCTTGTCTGG - Intergenic
936476705 2:112845878-112845900 CACAATATGAATAAGTTGACAGG - Intergenic
936531811 2:113281612-113281634 CAAAATATAAAAAATTAGTCAGG - Intergenic
937856327 2:126674367-126674389 CAGAAAGTAAGGAAGTTTTCTGG - Intronic
938319599 2:130354296-130354318 CAGAAAATAAAGACATTTTCTGG - Intergenic
939320487 2:140614079-140614101 AAAAATATAAATAATTTGTCAGG - Intronic
939710899 2:145518931-145518953 TTGAATATATAGAAATTGTCTGG + Intergenic
940072296 2:149702293-149702315 CATAATATAAATAAAGTGTCTGG + Intergenic
940100112 2:150027477-150027499 CAGAATCTTAGGAAGTTGTGGGG - Intergenic
940418823 2:153455191-153455213 CATAATATGAAGAAGTTCACTGG - Intergenic
940491867 2:154372151-154372173 CAGATTGTAAAGAAGTTACCTGG + Intronic
941118062 2:161494429-161494451 CAGTATATAAGCAAGTTTTCAGG + Intronic
941570598 2:167164961-167164983 CAGGATATAAAGAATTTTTAGGG - Intronic
941963570 2:171277609-171277631 CAGAAAATGGCGAAGTTGTCAGG + Intergenic
942322646 2:174749360-174749382 CAGAATGTAAAATATTTGTCAGG - Intronic
942938216 2:181584348-181584370 CAGAAAAAAAAAAAGTTGGCTGG + Intronic
943240350 2:185376731-185376753 CAGAATCTAGAGAAGCAGTCTGG + Intergenic
943475408 2:188348295-188348317 CGGAATATCAGGAAGTTATCTGG + Intronic
944293379 2:198033827-198033849 AAGAATATAAAGAAGAGGGCTGG - Intronic
944309250 2:198214890-198214912 GAGAATAAAAAGAATTTGACAGG + Intronic
947123810 2:226845577-226845599 CAGAATATAAAGAAGTTGTCAGG - Intronic
1172089372 20:32417880-32417902 CAAAAAATAAAAAAGTTGGCCGG + Intronic
1174489982 20:50886036-50886058 AAGAACATAAAGCAGTTGTGAGG + Intergenic
1178826662 21:36023109-36023131 CCAAATATAAAGAGGTTGTAAGG + Intergenic
1180401019 22:12425061-12425083 AAAAATATAAAGAAGGTTTCTGG + Intergenic
1181996652 22:26888151-26888173 CTGAATAAAAAGAAGCTGGCTGG + Intergenic
1183067531 22:35373318-35373340 CAAAATATAAAAAATTTGCCAGG + Intergenic
1183103928 22:35602484-35602506 CAGATTTTAAAGAAGTTGCCTGG + Intergenic
1184795553 22:46730420-46730442 CAAAAAAAAAAGAAGTTTTCAGG + Intronic
949177178 3:1079001-1079023 CAGAAAATAAACAATTTATCTGG + Intergenic
949437443 3:4044864-4044886 CAGAATCTAAAGAAAATGTCTGG - Intronic
951713726 3:25614098-25614120 CAGAATTTAAATAAGTTGTTTGG + Intronic
952950882 3:38524063-38524085 CAGGACCTAGAGAAGTTGTCAGG + Exonic
953994788 3:47511632-47511654 CAGAATATAAAGTAGTTGGCAGG - Intronic
957179633 3:76859738-76859760 CAGAATAGCAAGAAGATGTGTGG - Intronic
957729495 3:84114870-84114892 CATAATTTAAAGATGTTGGCTGG - Intergenic
957944361 3:87043704-87043726 CAGAATGTAAAGAAGAATTCAGG - Intergenic
958004704 3:87796043-87796065 CAGAATAGCAAGAAGTTATTGGG - Intergenic
958113944 3:89189704-89189726 TGGAATAAAAAGAATTTGTCAGG - Intronic
959039061 3:101399785-101399807 CAGAAAATAAAAAAGTTACCTGG - Intronic
959349221 3:105239492-105239514 GAGAAAATAAAGAAGCTATCAGG - Intergenic
959430896 3:106253774-106253796 CAGAATATAAAAATCTTGGCTGG - Intergenic
960239136 3:115319691-115319713 CATCATAGAAAGAAATTGTCTGG + Intergenic
961210728 3:125123448-125123470 CATAAAATAAAAAAGTTATCCGG + Intronic
961525657 3:127495745-127495767 CAGAATAAAAAGATGTTTCCTGG - Intergenic
965724375 3:171698659-171698681 CAGAATAAAAAAAGGTTGGCCGG + Intronic
966747503 3:183291589-183291611 CACAGTATAAAGAAGATGTGTGG - Intronic
969132489 4:5002072-5002094 AAGAATCTAAAGAAGCAGTCTGG + Intergenic
970017414 4:11527938-11527960 CAGAAAGCAAAGAAGCTGTCAGG + Intergenic
970696163 4:18679966-18679988 GAGAATGTAAAGAAGTTGGTAGG - Intergenic
971197194 4:24480833-24480855 CAGAAGATCAAGAAGAAGTCTGG + Intergenic
972905425 4:43740717-43740739 CAGAAAATCTTGAAGTTGTCAGG - Intergenic
972936794 4:44146333-44146355 CAGAATAGAATGTAATTGTCAGG + Intergenic
973121400 4:46524233-46524255 AGGAATATAATGAAGTTGTTTGG - Intergenic
974823234 4:67095002-67095024 CAGAAGATCATGAAGTTGTTTGG + Intergenic
976749514 4:88440088-88440110 TGGAATATATAGAAGTTGTTCGG - Intronic
978431141 4:108634615-108634637 CAAAATATAAAGCAGATGCCGGG + Intergenic
978767319 4:112417645-112417667 CAGAAAATAAACAAGTTAGCTGG - Intronic
979184058 4:117765672-117765694 GATAATTTAAAGAAGTTTTCTGG - Intergenic
980829561 4:138113336-138113358 CCGAATAAAAACCAGTTGTCAGG - Intergenic
981138796 4:141242886-141242908 AAGAATAAAGAGAAGTTGGCTGG - Intergenic
982448477 4:155523262-155523284 CAGAATAAAAAGTAATTGTTTGG - Intergenic
982576369 4:157115270-157115292 CAGAAATTAAAGAAGTGTTCAGG - Intronic
983910641 4:173235124-173235146 CAGAATAGACAGCAGTAGTCTGG - Intronic
984113965 4:175655102-175655124 CAGAGTAGAAAGAAGATGTAAGG - Intronic
984479428 4:180279736-180279758 CAGAAAATAAAAAAGTTAACGGG - Intergenic
985743168 5:1632136-1632158 CAGAATCTAAAGCAGTAGTCAGG + Intergenic
986587884 5:9337368-9337390 AAGTAGATAAATAAGTTGTCCGG - Intronic
988274228 5:29059721-29059743 CACAAAATAAAAAAGTTATCTGG - Intergenic
989542441 5:42632818-42632840 TAAAATATAAAAAAGTTGTTTGG - Intronic
989706025 5:44331960-44331982 CAGAATATAAATAACTTGAAGGG + Intronic
990040417 5:51372445-51372467 CAAAATATAGAGATGTTTTCTGG + Intergenic
992037887 5:72798834-72798856 CAGAAGAAAAAGAACTTGGCGGG + Intergenic
992733719 5:79698008-79698030 CAGCATATAAGGAAGTTATTTGG - Intronic
993567901 5:89498183-89498205 CAATATATAAATAAGTTCTCAGG + Intergenic
994455012 5:99994861-99994883 CAAAATACAAAGAATTAGTCGGG - Intergenic
995322833 5:110856500-110856522 AAGACTATAAAGAAGATGTAAGG - Intergenic
995632887 5:114153184-114153206 CAGAATATATTCATGTTGTCAGG + Intergenic
995696418 5:114883278-114883300 CAGAGTAAAAAGAGGTTTTCTGG - Intergenic
996145827 5:119974779-119974801 CAGAATTTGAAGATGTTGTTTGG + Intergenic
996240842 5:121199344-121199366 CAAAATATGAAGTAGATGTCAGG + Intergenic
996909091 5:128635020-128635042 AGGAATATAATGAAGTTGTTTGG - Intronic
998547250 5:143040311-143040333 ATGAATAAAAAGAAGTGGTCTGG - Intronic
998664236 5:144277919-144277941 CAGAATATAAATACTTTGTTGGG + Intronic
999659096 5:153840177-153840199 GAGAATAGAAAGAAATAGTCAGG - Intergenic
999830240 5:155312092-155312114 CAAACTGTAAAGAAGTTTTCTGG - Intergenic
1000495337 5:161975932-161975954 CAGAAAAAAAACAAATTGTCTGG + Intergenic
1000892380 5:166815246-166815268 AAGAATATAAAAAAGTGGGCTGG - Intergenic
1000894990 5:166844902-166844924 CTGAAAATACAGAAGTTATCTGG - Intergenic
1003397230 6:5763828-5763850 CAGGATTTAAATAAGTGGTCTGG - Intronic
1004065199 6:12237358-12237380 AAGAATATAAAGAGGTTTTCAGG + Intergenic
1004520480 6:16356996-16357018 AAGAATATAAAGAGGTGGTGTGG - Intronic
1005805234 6:29468379-29468401 CAGGATATAATGAGGTAGTCTGG - Intergenic
1005813904 6:29535174-29535196 CAGGATATAGTGAGGTTGTCTGG - Intergenic
1007235360 6:40387373-40387395 CAGAAGATACAGAAGTACTCAGG + Intergenic
1007326112 6:41061338-41061360 TGGAATTTAAAGAAGTTGGCAGG - Exonic
1008921253 6:56845476-56845498 CAGATTATAAACCAGTGGTCAGG - Intronic
1009284349 6:61797019-61797041 CAGAATAAAACGAAGTAGTCTGG + Intronic
1010355076 6:74922971-74922993 AAGAATATAAAAAATTTGCCGGG - Intergenic
1012411421 6:98962408-98962430 CAGTATACAGAGAAGATGTCTGG + Intergenic
1012629135 6:101441892-101441914 CAGAACATAAGAAAGTAGTCTGG + Intronic
1012745478 6:103081717-103081739 GAGAATTTAAAGAAGTTTTCTGG - Intergenic
1014541919 6:122686656-122686678 CAGAAATTAAAGAAGTTATCTGG - Intronic
1014747697 6:125219250-125219272 TAAAATATAAAGAAGTTCCCTGG - Intronic
1016257868 6:142130673-142130695 CAAATTATAAAGAAGATTTCTGG + Intergenic
1016300592 6:142626793-142626815 CAGCAAATAAAAATGTTGTCTGG - Intergenic
1016716259 6:147234434-147234456 TAGAATATAAATAAGCTTTCTGG - Intronic
1017419382 6:154257997-154258019 CAGAATAGAAAAAAGTTATCTGG - Intronic
1017634955 6:156434823-156434845 CAGAACATAAAGAGTTTGTTTGG - Intergenic
1018140444 6:160828481-160828503 AAGAATAGAATAAAGTTGTCTGG + Intergenic
1019013480 6:168861876-168861898 CAGAATATGAACAATTTCTCAGG + Intergenic
1019555786 7:1630600-1630622 CATTATATAAAGAATTAGTCTGG - Intergenic
1021187891 7:17586495-17586517 CAGAAGACACAGAAGTTGTAAGG - Intergenic
1021728520 7:23573663-23573685 CAAAAAATAAAGAATTTGCCAGG - Intergenic
1022881245 7:34589879-34589901 CAGCGAATAAAGAAGTTGCCTGG + Intergenic
1023271366 7:38466646-38466668 TAAAATATAAATAAGTTCTCAGG - Intronic
1023430835 7:40089242-40089264 CAGAGTTTCAGGAAGTTGTCTGG - Intronic
1023476554 7:40585532-40585554 CAAAAAATAAAGTAATTGTCAGG - Intronic
1025638398 7:63345268-63345290 AAGAATAAAAATAAGTTTTCAGG - Intergenic
1025644298 7:63402821-63402843 AAGAATAAAAATAAGTTTTCAGG + Intergenic
1025713888 7:63935885-63935907 AAGAATAAAAATAAGTTTTCAGG + Intergenic
1028070769 7:86447326-86447348 CAGAACAGAAAGAAGTAGTGAGG + Intergenic
1029461318 7:100695209-100695231 CAGAGAATAAAAAAGTTATCTGG - Intergenic
1031186458 7:118486626-118486648 CAGAATAGAAAAAAGATGTTAGG - Intergenic
1031575523 7:123411257-123411279 CATAATATAAAAAATTTTTCTGG + Intergenic
1031934327 7:127720602-127720624 CAGAAGAAAAAGAACTAGTCTGG - Intronic
1032160436 7:129505435-129505457 CAGAATATAGACATGGTGTCAGG + Intronic
1032299992 7:130677979-130678001 CAGAATATAAAGATGATTACAGG - Intronic
1032731473 7:134647209-134647231 AAGAATATATAGAAGTTGGAGGG + Intronic
1033068231 7:138176700-138176722 CAAAATATATACAAATTGTCAGG - Intergenic
1033309502 7:140250584-140250606 CAAAAAATAAAAAATTTGTCAGG - Intergenic
1033513066 7:142079786-142079808 CAGATTGTAAAGAAATTTTCAGG - Intronic
1034080486 7:148273161-148273183 CTGTATATTAAGGAGTTGTCTGG + Intronic
1037258262 8:16979524-16979546 AAGAATATAGAGAAGCAGTCTGG + Intergenic
1037428459 8:18783791-18783813 CAGAATACAAAAAATTTGCCAGG - Intronic
1037794038 8:21976597-21976619 CAGAATACACAGGAGTTGCCAGG - Intronic
1039102431 8:33955281-33955303 CAAAAAATCAAGAAGTTCTCTGG - Intergenic
1039527275 8:38228048-38228070 CAGAACCTAAAGAATTTATCTGG + Intronic
1039697565 8:39928918-39928940 AAGAATATAGACAAGTTGACAGG - Intergenic
1039779005 8:40765211-40765233 GAATATATAAAGACGTTGTCTGG - Intronic
1039853240 8:41390149-41390171 CGGAAAATAAAGAAGTGCTCAGG + Intergenic
1040794787 8:51277310-51277332 GAGAATATAAAAAAGCTTTCAGG + Intergenic
1041621573 8:59976047-59976069 CTGAATGTGAAGTAGTTGTCTGG + Intergenic
1043189230 8:77196488-77196510 CAACTAATAAAGAAGTTGTCAGG + Intergenic
1043316613 8:78930377-78930399 CAGAATAAAATAAAGTTGTTAGG - Intergenic
1043786629 8:84409876-84409898 TAGAATATAAAAGAGTTTTCTGG - Intronic
1044693797 8:94903196-94903218 CAAAAAATAAAGAAGTTAGCTGG + Intronic
1044781035 8:95743744-95743766 CAAAATATAAAGAAGTTAGCTGG + Intergenic
1045280732 8:100747428-100747450 CAGAAAATAAAAAATTAGTCAGG + Intergenic
1047203513 8:122785353-122785375 CAGTGTAGAAAGAAGTAGTCTGG - Intronic
1049878314 8:145042652-145042674 AAGAAAATAAATAAATTGTCTGG - Intergenic
1050707897 9:8424662-8424684 CAGAAAATAAAGAAGGGGACTGG + Intronic
1050752381 9:8955210-8955232 CAGAATATGAAAAAGTTGGCTGG + Intronic
1050806292 9:9682685-9682707 CAGCAGATAAGGAAATTGTCTGG + Intronic
1051108959 9:13613280-13613302 GAGAAGATAAAGAATTTGTCAGG + Intergenic
1051139303 9:13961478-13961500 GACAATATAAAGAAGCTGACTGG - Intergenic
1052452206 9:28645761-28645783 CAGACTATAATCAAGTTATCAGG + Intronic
1054712603 9:68526180-68526202 CAAAATCTAAAGAAGTTCTGTGG + Intronic
1055437677 9:76308920-76308942 GACAATACAAAGAAGTGGTCAGG + Intronic
1055760438 9:79601303-79601325 CAGAATTTAAGCAAGTTTTCTGG + Intronic
1055801420 9:80040537-80040559 AACAATACAAAGAAGTTGACAGG + Intergenic
1058250032 9:102681935-102681957 GAGAATATAAGGCAATTGTCAGG + Intergenic
1059425674 9:114219599-114219621 CTGAACATAAAGAATTTCTCAGG - Intronic
1059656573 9:116362956-116362978 CAGAATACAGAAAAGCTGTCAGG + Intronic
1060639955 9:125230123-125230145 CAGAAAATAAAAAAATTATCTGG - Intronic
1203382366 Un_KI270435v1:67726-67748 AAAAATATAAAGAAGGTTTCTGG + Intergenic
1186303340 X:8226037-8226059 CAGAAAATTAAAAAGTTGTGTGG - Intergenic
1186851179 X:13581594-13581616 GAGAATATCATGAAGTTTTCTGG + Intronic
1187974093 X:24687777-24687799 CAGAATATAATCCAGTTGGCTGG + Intergenic
1188057313 X:25556316-25556338 CATAATATAAAGAAGTCCTTGGG + Intergenic
1188878060 X:35456755-35456777 TAGAATTCAAAAAAGTTGTCCGG - Intergenic
1188949426 X:36350577-36350599 CAGAATGTACTGAAGTTTTCAGG + Intronic
1189221369 X:39375104-39375126 AAGAATACAAAAAAGTTATCCGG + Intergenic
1189375465 X:40463075-40463097 CAGAATACAAAGAAGTGGAGGGG + Intergenic
1189579952 X:42395812-42395834 CATAATATGAAGAGGTTGGCAGG - Intergenic
1189669955 X:43397472-43397494 GAGAATATAAAGATATTTTCAGG + Intergenic
1190088426 X:47416535-47416557 CAAAATATAATGATGTTGTGGGG + Intergenic
1190269299 X:48850419-48850441 AAAAATACAAAAAAGTTGTCGGG + Intergenic
1190858033 X:54316377-54316399 AAAAATATAAAGAAGTAGCCAGG + Intronic
1191262776 X:58345244-58345266 AAAAATACAAGGAAGTTGTCTGG + Intergenic
1193761952 X:85477777-85477799 CAGACTTTAAAAATGTTGTCAGG - Intergenic
1194082727 X:89488225-89488247 CAAAAGATAAAGGAGTTGGCAGG - Intergenic
1195058559 X:101171434-101171456 CAAAATAAAAAAAAGTTTTCTGG - Intergenic
1195118050 X:101719489-101719511 CAGAAAATAGAAAAATTGTCTGG + Intergenic
1195373729 X:104204842-104204864 CATAATCTAAAGAAGCTGTGTGG + Intergenic
1196080427 X:111624563-111624585 AAGAAGATGAAGAAGTTTTCAGG - Intergenic
1198030648 X:132750664-132750686 CAGAAGATAAAGGAGCTCTCAGG + Intronic
1198387108 X:136139683-136139705 TGGAATATAAAAAAGTTTTCTGG - Intergenic
1200435378 Y:3144096-3144118 CAAAAGATAAAGGAGTTGGCAGG - Intergenic