ID: 947126900

View in Genome Browser
Species Human (GRCh38)
Location 2:226878719-226878741
Sequence CTGTGGGTCAGGAATTCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 431
Summary {0: 1, 1: 8, 2: 28, 3: 62, 4: 332}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947126900_947126908 25 Left 947126900 2:226878719-226878741 CCTTCTGAATTCCTGACCCACAG 0: 1
1: 8
2: 28
3: 62
4: 332
Right 947126908 2:226878767-226878789 CTTTGGTCCCACTAGATTTGGGG 0: 1
1: 0
2: 0
3: 17
4: 119
947126900_947126907 24 Left 947126900 2:226878719-226878741 CCTTCTGAATTCCTGACCCACAG 0: 1
1: 8
2: 28
3: 62
4: 332
Right 947126907 2:226878766-226878788 TCTTTGGTCCCACTAGATTTGGG 0: 1
1: 0
2: 0
3: 8
4: 128
947126900_947126904 8 Left 947126900 2:226878719-226878741 CCTTCTGAATTCCTGACCCACAG 0: 1
1: 8
2: 28
3: 62
4: 332
Right 947126904 2:226878750-226878772 ACTCCAAGAAAACGTTTCTTTGG 0: 1
1: 0
2: 1
3: 12
4: 153
947126900_947126906 23 Left 947126900 2:226878719-226878741 CCTTCTGAATTCCTGACCCACAG 0: 1
1: 8
2: 28
3: 62
4: 332
Right 947126906 2:226878765-226878787 TTCTTTGGTCCCACTAGATTTGG 0: 1
1: 0
2: 0
3: 11
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947126900 Original CRISPR CTGTGGGTCAGGAATTCAGA AGG (reversed) Intronic
900764486 1:4494767-4494789 GCGTGGGTCGGGCATTCAGAGGG - Intergenic
901842213 1:11960842-11960864 CTGAGTGACAGGAGTTCAGAAGG + Intronic
902122890 1:14182984-14183006 CTGTGGGTATGGAACTGAGAGGG - Intergenic
902127380 1:14227289-14227311 CTATGGGTCAGGAATTCAGAAGG + Intergenic
902263023 1:15241096-15241118 CTGTGGGTCAGGAATTGGGCAGG - Intergenic
902433951 1:16384911-16384933 CTGTGGGGCAGCGATTCATAGGG + Intronic
902775360 1:18671124-18671146 CTGTGGGGCAGGAAGGCAGCAGG + Intronic
902888860 1:19426759-19426781 CTGTGGGTCAGGAGTTCAGGAGG - Intronic
903437461 1:23361807-23361829 CTGAGGGTCAGAATTTCAAATGG + Exonic
905952201 1:41961299-41961321 ATGTGGGTCAGGGATTCAGGTGG - Intronic
906243039 1:44253918-44253940 CTGTGACTGAGGAATTCAGGAGG - Intronic
906387011 1:45378633-45378655 TTGTAGGTCAGGTATGCAGAAGG - Intronic
906499032 1:46327141-46327163 TTGTGGGCCAGGAATTCATCAGG + Intergenic
908353441 1:63308746-63308768 CTGTGGATCGGGAATTCAGAAGG - Intergenic
909198523 1:72658435-72658457 CTATGGGTCTGCAATTCAGAAGG - Intergenic
909835062 1:80243795-80243817 CTATGAGTCAGAAATTCAGCTGG + Intergenic
911193914 1:94974804-94974826 CTGTGGATCAGCAAATCACAGGG + Exonic
912814448 1:112817897-112817919 CTGTGGGTCAGGCCCTCACAGGG - Intergenic
912922029 1:113877959-113877981 CTGTGGGTATGGAATTGAGAAGG + Intergenic
916048436 1:161018192-161018214 CTGTGGGGCAGAGATCCAGAGGG - Intronic
916571154 1:166028944-166028966 CTGTCGGTCAGGAATTTGGGAGG + Intergenic
917664008 1:177206263-177206285 CTGTGGGTCAGAAATTTGGGTGG - Intronic
918279782 1:182993129-182993151 CTGTAGGTCAGGTATTCAAGTGG + Intergenic
919658541 1:200220897-200220919 CTGTGGGTTAGGAACACAAATGG - Intergenic
920710396 1:208289096-208289118 CTTTGGGTCTGGAACTCAGTAGG + Intergenic
921407828 1:214800053-214800075 CTGTGGGTCATGAGGGCAGAAGG + Intergenic
921782657 1:219185589-219185611 TTGTGGGCTAAGAATTCAGAAGG + Intronic
923034097 1:230272092-230272114 CTGTGGCTCAGGAAATGACAAGG + Intronic
924106892 1:240658196-240658218 CTGTGAGTCAGGAATTCAGGAGG + Intergenic
1062810354 10:458801-458823 CGGTGAGTCAGGAATGTAGAGGG - Intronic
1063665970 10:8060890-8060912 CTGTGAGAAAGGAATTAAGAAGG - Intronic
1064391660 10:14947399-14947421 CTGTGGATCAGGGATTGACAGGG - Intronic
1065072892 10:22045710-22045732 CTGTGGGTCAGGAATCCAGAAGG - Intergenic
1065111200 10:22441834-22441856 CTTTGGGTTAGGAATACAGGCGG + Intronic
1065766225 10:29032238-29032260 CTGTGAGTCAGAAATTCATCAGG - Intergenic
1067452891 10:46393185-46393207 CTGTGGGTCAGCAGTTCTGGAGG + Intergenic
1067535328 10:47105197-47105219 CTGTGGACCAGGAGTTCAGCTGG - Intergenic
1067584341 10:47466574-47466596 CTGTGGGTCAGCAGTTCTGGAGG - Intronic
1067724880 10:48762511-48762533 CTGTGGGTCAGGGATTCAGAAGG + Intronic
1067775532 10:49162518-49162540 ATGTGTGCCAGGAATTCAGATGG + Intronic
1070321172 10:75355776-75355798 CTATGGGTCTGGAATTCAGATGG + Intergenic
1071461724 10:85903120-85903142 CTATGAGTCTGGAGTTCAGAGGG - Intronic
1072984947 10:100131089-100131111 CTGTGGGTCAGGAATCTGAACGG - Intergenic
1074576467 10:114674434-114674456 TTGGTGTTCAGGAATTCAGAAGG + Intronic
1074603367 10:114936855-114936877 CTGGGGGTGAGGGATGCAGAGGG - Intergenic
1075064007 10:119277125-119277147 CAGTGGGTCATGGATCCAGAAGG + Intronic
1075395156 10:122121755-122121777 CTGTGGGCTAAGAATTCAGCAGG + Intronic
1075965856 10:126610846-126610868 CTGTAGGTGAGGTTTTCAGATGG - Intronic
1078182960 11:9027759-9027781 CAGTGCCTCAGGAACTCAGAGGG - Intronic
1079663548 11:23073671-23073693 CTGTAGATGAGGTATTCAGAGGG - Intergenic
1080457205 11:32428416-32428438 CTGTGGGTTAGGAATTCCTGGGG + Intronic
1081482669 11:43504161-43504183 CTGAGAATCAGGAATGCAGAGGG + Intergenic
1082141873 11:48618317-48618339 TTGTGAGCCAGGAATTCAGGTGG + Intergenic
1082877316 11:58001433-58001455 CTGTGGTTCAGGAAAACAGGAGG - Intergenic
1083712116 11:64555892-64555914 CTGAGGGGCAGGAAGGCAGAAGG + Exonic
1084032593 11:66489661-66489683 CTCTGGGTCAGGAATGCAGGTGG + Intronic
1085242959 11:75073863-75073885 CTGAGGGACAGAAACTCAGAAGG + Intergenic
1085466441 11:76726978-76727000 CTCTTGGGCAGGATTTCAGAGGG - Intergenic
1085852009 11:80131514-80131536 ATGGGGGTCAGCAATTTAGATGG - Intergenic
1087334869 11:96830858-96830880 CAGTATGTCAGCAATTCAGAAGG - Intergenic
1087945640 11:104157285-104157307 CTGTGGCACATGAATACAGATGG - Intronic
1088717121 11:112558681-112558703 CTGTGGGTCAGGAAGCCAAGTGG + Intergenic
1088992289 11:114964080-114964102 CTGTGAGTTAGGAATCTAGAAGG + Intergenic
1089636240 11:119814281-119814303 CTGTGGGTGAGGAATGCAGCAGG - Intergenic
1091186834 11:133655022-133655044 CTGTGTGTCAGGAAATGAGGAGG - Intergenic
1092162518 12:6323894-6323916 CTGTTGCTCAGGAAGTCAGTGGG + Intronic
1094632291 12:32187782-32187804 ATTTGGGTAAGGAATTCAGCAGG + Intronic
1094731819 12:33185389-33185411 GGCTGGGTCAGGACTTCAGATGG + Intergenic
1097650906 12:62296303-62296325 CTGTGGGTCAGTAGTTAAGGAGG - Intronic
1097768054 12:63548100-63548122 CTGTGGGTTAGGAATTAGGTGGG - Intergenic
1097784415 12:63743166-63743188 CTGTGGGTTAGGAATTAGGTGGG - Intergenic
1098080613 12:66780992-66781014 TTATGGGTCAGGGATTCAGATGG - Intronic
1098088342 12:66872867-66872889 CAGTGGGTCAGGAAATTGGATGG + Intergenic
1099880016 12:88456513-88456535 CTGTGGGTCAGAAATCCAATGGG + Intergenic
1101652228 12:106687873-106687895 CTGTGGAAAAGCAATTCAGAGGG - Intronic
1102123167 12:110458971-110458993 CTGAGGGTGAGGAAGGCAGAGGG - Intronic
1102202892 12:111069839-111069861 CTGGGGGTTAGGACTTCAGTTGG + Intronic
1102727363 12:115077498-115077520 CTGTGGGTCAGGAATTTGGATGG - Intergenic
1103429963 12:120875161-120875183 CTGTGGGTTAGGCATTTGGATGG - Intronic
1103539975 12:121659245-121659267 CTGTTGGTCAGGAAGGCTGAGGG + Exonic
1104278978 12:127356411-127356433 CTGTAGGTCAGGAGTTTAAAAGG + Intergenic
1104529016 12:129551214-129551236 CCGTGGGTCAGGAACTTGGAAGG - Intronic
1104596516 12:130124081-130124103 CCATGGGTCTGGAATTCAGCAGG + Intergenic
1105825428 13:24118576-24118598 CACTGGGTCAGAAATTCAGGGGG - Intronic
1107019411 13:35736221-35736243 CTGTTGCTCAGGAATTTACAAGG + Intergenic
1107153407 13:37139064-37139086 CTGTGGTCCTGGATTTCAGAAGG + Intergenic
1107760475 13:43672866-43672888 CTGTAGGTAGTGAATTCAGATGG - Intronic
1108602614 13:52007728-52007750 CAGTTGGTCAGGAGTACAGATGG - Intronic
1110358261 13:74594562-74594584 CTGCGCGTCAGGAATCCAGGAGG - Intergenic
1111166034 13:84458097-84458119 CTAATGGTCAGGAATTCAGTTGG + Intergenic
1111556589 13:89888996-89889018 CTGTGGGTCAGCTCTTAAGAAGG + Intergenic
1111971706 13:94923693-94923715 TTGTGGGTCAGGAATTCAGATGG - Intergenic
1112308473 13:98296612-98296634 ATGTGGCTCAGAACTTCAGAAGG - Intronic
1112694819 13:101936222-101936244 TCGTGGGTCAGGCATTAAGAAGG - Intronic
1113672727 13:112185796-112185818 CTGTGGGTCAGGAACAGGGATGG - Intergenic
1114393562 14:22336462-22336484 CTCTGGGTCAGAAATTGAGGTGG - Intergenic
1115325100 14:32129109-32129131 CTGTGAGTCAGGAAAACATATGG + Intronic
1115376372 14:32681412-32681434 CTCTGGGTCAAGAATGCAGAAGG + Intronic
1115851948 14:37595775-37595797 CTTTGGGTCAGGAATCAGGAGGG - Intronic
1116397998 14:44470660-44470682 CTGTTGGTCAGGAAGTTGGAAGG - Intergenic
1116800434 14:49437986-49438008 CTGTGGACCAGGAATCCAGGAGG - Intergenic
1117020227 14:51562879-51562901 CTGCTGGTCAAGAATTCAGACGG + Intronic
1117166252 14:53036922-53036944 CTGTGGGTGAGGAGGGCAGAAGG - Intronic
1117928516 14:60812343-60812365 CTGTGGGTTAGGAATTTAAGTGG + Intronic
1118228843 14:63928980-63929002 CTGTGGTTCAGGAAATTACAAGG - Intronic
1119543784 14:75457405-75457427 CTGTGGGGCATGAAGGCAGAGGG + Intronic
1119771803 14:77224763-77224785 CTGAGGTGCAGGAATTCAGAGGG + Intronic
1119853244 14:77881152-77881174 CTTTGGGTCAGGAATTTGGGAGG + Intronic
1120750984 14:88198159-88198181 TTGTCAGTCAGGCATTCAGAAGG + Intronic
1121101104 14:91250953-91250975 CTGTTGGTTAGGCAGTCAGAGGG - Exonic
1123401501 15:19991239-19991261 CTGTGGGTCTGTAACTCACAGGG - Intergenic
1123823902 15:24061927-24061949 CTCTGGGTCAAGAATTCAACTGG + Intergenic
1123851830 15:24365318-24365340 CTCTTGGTCAGGAATCTAGATGG - Intergenic
1124106320 15:26740953-26740975 CTCTGAGTCAGAATTTCAGATGG + Intronic
1124395617 15:29299289-29299311 CTGTGGGTCAGGAATTCTCCAGG + Intronic
1124399396 15:29335117-29335139 CTGTGAGTGAGGAATTTAGCAGG - Intronic
1124650894 15:31473184-31473206 CTGTGCCTCAGGAAGCCAGAGGG - Intergenic
1125310324 15:38372098-38372120 CTGTGGGTCTGGAATTCAGGAGG - Intergenic
1127534214 15:59874859-59874881 CTGTGGCTCTGGTAGTCAGAGGG - Intergenic
1127662247 15:61110965-61110987 GTGTGGAGCAGGAATACAGAAGG - Intronic
1127975314 15:63992791-63992813 CTGACTGTCAGGAACTCAGATGG - Intronic
1128175374 15:65550687-65550709 CTGTGGGTTAGGACTTCAGGAGG + Intronic
1128717876 15:69921907-69921929 TTGTGGGGCAGGGATTCAAATGG + Intergenic
1130076893 15:80696595-80696617 CTGTGGGGCAGGAAGTTAGCTGG + Intronic
1130317072 15:82805369-82805391 CTGTGGCTCAGGAATTGCCAAGG - Intronic
1130788445 15:87125651-87125673 CTGTGGCTCCTGAATCCAGAAGG - Intergenic
1131298323 15:91172215-91172237 CTGTGGGACAGGGATGCAGAGGG - Intronic
1131301979 15:91207701-91207723 CTCTGGGTCATGATTTCTGAAGG - Intronic
1131670680 15:94616496-94616518 TTGTGGGTCAGAAATTTGGATGG + Intergenic
1133838809 16:9389846-9389868 CTGTGGGTCAGGAATCAGGGTGG - Intergenic
1134104646 16:11477020-11477042 CTGTGGCTCAGGACTGCAGGGGG - Intronic
1134214676 16:12307874-12307896 TGGTGGGCCAGGAGTTCAGAAGG - Intronic
1135189019 16:20339391-20339413 CTTTAGGTCATGAATTCAAATGG + Intronic
1135842718 16:25891341-25891363 CTGTGGGTCAGGCATTTAGGAGG + Intronic
1137379517 16:47984325-47984347 CTATGAGTCAGGAAGTCTGATGG + Intergenic
1137546754 16:49410160-49410182 CTGTGGGTCAGGAACACAGTGGG + Intergenic
1138110461 16:54319778-54319800 TTGTGTGTCAGGAACTAAGAAGG + Intergenic
1138729435 16:59178580-59178602 CTGTGGGTCAGACATTCAACAGG + Intergenic
1139037472 16:62965217-62965239 CTGTGGGTGAGGATTTTGGAAGG + Intergenic
1139396184 16:66640997-66641019 CTGTGTGTCAGGAATTTGGGGGG - Intronic
1140746539 16:77985580-77985602 TTGTGGGTCATGATTTCAGCCGG - Intergenic
1141055514 16:80810212-80810234 ATGTGAGTCAGGAACTCAGCCGG + Intergenic
1141113033 16:81285913-81285935 CTGAGGGTAAGGAAGTCAGCAGG + Intronic
1141187354 16:81797482-81797504 CTGTGGGTCAGGACTACCGAAGG - Intronic
1142527211 17:551995-552017 CTGAGTGTCAGTCATTCAGACGG - Intronic
1143659875 17:8318327-8318349 CTGTGGCCCTGGGATTCAGAGGG - Intronic
1143875796 17:9989904-9989926 CTTGGGGTCAGGAAGTCAGTGGG + Intronic
1144470455 17:15535537-15535559 GTGTGGGACAGGAATTTGGATGG - Intronic
1144925886 17:18808135-18808157 GTGTGGGACAGGAATTTGGATGG + Intergenic
1147506406 17:41021853-41021875 TTGTGGGTCAGGAGTACAGCAGG - Intergenic
1148178794 17:45588560-45588582 CTGTGGGTCAGGAATCTGGGAGG - Intergenic
1148586586 17:48785642-48785664 CTGTGGGTCAGCTATCCAGCTGG - Intronic
1148792520 17:50181397-50181419 CTGTGGGTCAGGGCTGCAGCGGG - Intergenic
1148825977 17:50394726-50394748 CAGTGGGAAAGGAATTGAGATGG - Intronic
1149693186 17:58595770-58595792 CTGTGGGTCAGGAATTTGACAGG - Intronic
1149911018 17:60566809-60566831 CTGTGGGTCATAAATTGGGAAGG - Intronic
1151076947 17:71284732-71284754 CTGGGGGTCAGGAATTCAAATGG - Intergenic
1153092862 18:1368598-1368620 CTGTGGGGCAGAAAGTCAAAAGG + Intergenic
1156310561 18:35918489-35918511 CTGGGGGTCAGGAGTGCAGAGGG + Intergenic
1156452918 18:37276691-37276713 CCATGGGTCAGGAATTCACAGGG - Intronic
1157888706 18:51394120-51394142 CTGTGGGTCAGGAATTTGGGAGG + Intergenic
1157967094 18:52220616-52220638 CTGTGGGTCAGGAAGTTGGCTGG - Intergenic
1158241005 18:55378173-55378195 CTGTGGGTCAAGTATTCTTAGGG - Intronic
1158326606 18:56319826-56319848 CTCTGGTTCTGGAGTTCAGAAGG - Intergenic
1158603010 18:58870937-58870959 CTGTGAGTCTGGAATTTAGGAGG + Intronic
1158691079 18:59661311-59661333 CTGGGGGTTAAGAATCCAGAGGG + Intronic
1159274065 18:66192852-66192874 CTTTGGGACAGGATTTCAGAAGG + Intergenic
1159839643 18:73383795-73383817 ATGTGGGTAAGGAACTCTGATGG + Intergenic
1160077506 18:75692338-75692360 CTGAGAGACAGTAATTCAGATGG + Intergenic
1160537560 18:79603195-79603217 CTGTGGGCCAGAAGTTCCGAAGG + Intergenic
1162901420 19:13797127-13797149 CTGTGGGTCAAGAACTCTGAGGG - Intronic
1164457358 19:28419944-28419966 CTGTGGGTCAGGTGTTCTCACGG - Intergenic
1165574062 19:36799097-36799119 CTGTGGGTAATAAACTCAGAAGG - Intergenic
1166250144 19:41564285-41564307 ATTTGCGGCAGGAATTCAGAAGG - Intronic
925522793 2:4766360-4766382 CTGTGGTTCTAGAATTGAGATGG + Intergenic
925977487 2:9151199-9151221 CTGTGGGTCAGGAACGCGGTGGG - Intergenic
925989591 2:9243455-9243477 CTGTTGTTTAGGAACTCAGACGG + Intronic
926059342 2:9795422-9795444 TTGTGGGTTAGGAATTCAGTGGG + Intergenic
926530075 2:14033225-14033247 CTGTGGGTCAGAAATTAGGGAGG - Intergenic
927490112 2:23515635-23515657 CTGTGGGCCAGGAATTGTGCTGG - Intronic
927810830 2:26179469-26179491 CTGTGGGGCAGGCATGGAGAAGG + Intronic
928624507 2:33125895-33125917 CTGTGGTTCAGGAATTTAGAGGG + Intronic
928635466 2:33241367-33241389 ATGGAGGACAGGAATTCAGACGG - Intronic
928682796 2:33719825-33719847 CTGTGGGCCAAGAACTCTGATGG - Intergenic
930214978 2:48685898-48685920 CTGGGGGTCAGGAATTAACTGGG + Intronic
931300130 2:60971767-60971789 CTGTGGCCTAGGAATTCAGCCGG + Intronic
931387333 2:61809429-61809451 TTATGAGTCTGGAATTCAGAAGG - Intergenic
932609173 2:73186142-73186164 CTGGGGGTCAGGAATTTGGGCGG + Intergenic
934539662 2:95163259-95163281 CTGTGGGTCGGGAACTTGGATGG - Intronic
935157566 2:100496902-100496924 CTGTTTGGCAGCAATTCAGAGGG - Intergenic
935205983 2:100896765-100896787 TAGTGGCACAGGAATTCAGATGG + Intronic
935680498 2:105632255-105632277 CTGTGCGTGAGCACTTCAGAAGG + Intergenic
936715392 2:115181353-115181375 CTGTTGGTCAGGAGTTCAGGTGG + Intronic
936732902 2:115405492-115405514 CTGTGGGTCTGGAGTCCAGAGGG + Intronic
937446410 2:121962515-121962537 CTAGAGGTCAGGAAGTCAGAGGG + Intergenic
938310286 2:130285012-130285034 CTGAGGGGCAGGAAGGCAGAGGG - Intergenic
938570144 2:132555328-132555350 CTTTTGGTCAGGAATGCAGAAGG + Intronic
938707325 2:133943840-133943862 CTGAGGGTCAGGAATCCTGGAGG + Intergenic
938831821 2:135057603-135057625 CTCAGGGTTAGGAATTCAAAGGG + Intronic
939635592 2:144578657-144578679 CAGTAGGTCATGAATACAGATGG + Intergenic
940320409 2:152370857-152370879 CTATGGGTCAGGAATTTGGGTGG + Intronic
940323868 2:152404574-152404596 ATGTAGGTAAGGGATTCAGAAGG + Intronic
941023580 2:160436486-160436508 CTGTGGCTCAGGAATTTGGAGGG - Intronic
941140048 2:161768870-161768892 CTGTGGGTCAGGTATTACAAGGG - Intronic
941296961 2:163750725-163750747 CTGTGGGTCAGGAATTGTTTTGG - Intergenic
942191616 2:173476174-173476196 CTGTGGGTCAGAAATTCATGAGG - Intergenic
942248041 2:174025372-174025394 CTGTGGGCCAGGATTGCATAGGG - Intergenic
942543718 2:177041025-177041047 CTGTGTGTCAGGTTTTTAGAAGG - Intergenic
942627071 2:177912594-177912616 CTGAGGGTCTGGAAATAAGAGGG - Intronic
942655845 2:178213293-178213315 ATGTGCCTCTGGAATTCAGAAGG - Intronic
944566384 2:200995776-200995798 TTGTGGGTCAGGAATCCAGATGG - Intronic
944939179 2:204604832-204604854 TTGTGGGTCAGGAATTTGGATGG + Intronic
945306728 2:208266210-208266232 CTGGGGGACAGGAAAACAGAGGG + Intergenic
946105542 2:217366309-217366331 CTGTGTGCTGGGAATTCAGAAGG - Intronic
946811639 2:223531412-223531434 CAGTGGGTCAGAAATTCTGAAGG + Intergenic
947126900 2:226878719-226878741 CTGTGGGTCAGGAATTCAGAAGG - Intronic
947994671 2:234516961-234516983 CTGCAGGTCAGCAATTCATAAGG + Intergenic
948182128 2:235990345-235990367 CTGTGGGTCAGGAATTAGAATGG + Intronic
1168861520 20:1049100-1049122 GTGTGGGGCAGGAATCCAGAAGG - Intergenic
1169418762 20:5441993-5442015 CGTTGGTTCAGGAAGTCAGAGGG - Intergenic
1169647405 20:7827959-7827981 TTATGGGTCAGGAATTCAGAAGG - Intergenic
1169806933 20:9569066-9569088 CTGTAGGTCACAAATTGAGAGGG - Intronic
1169967313 20:11232305-11232327 CTGAGGGTGGGGAGTTCAGATGG - Intergenic
1170157071 20:13278707-13278729 CTGTGGGTCAGGAATTTGACTGG + Intronic
1170455680 20:16530644-16530666 CTGTGGGTCAGGAATCTGGGTGG - Intronic
1170512836 20:17096685-17096707 CTGTGGGTCAGGGGTTTGGATGG - Intergenic
1170757429 20:19216824-19216846 CTTTGGGTCAGGAATTTGGATGG + Intronic
1170879881 20:20287561-20287583 GTGTGGGGCAGGAATACTGAAGG + Intronic
1171037801 20:21730065-21730087 CTGTGAGTCAAGAAGTTAGAAGG + Intergenic
1171042278 20:21776557-21776579 GTGTGGGTCTGGAAGGCAGAAGG + Intergenic
1171308471 20:24126168-24126190 CTTTGGGTGAGGGATTCAGCAGG + Intergenic
1171329984 20:24329065-24329087 CTGATGGTCAGGAACTTAGAAGG - Intergenic
1171348069 20:24481253-24481275 CTGTGGGTCAGGAATTTGAAAGG + Intronic
1171394095 20:24819867-24819889 CTGTGGGTAAGGAATTTGGAAGG - Intergenic
1171457449 20:25280089-25280111 CTGCGTGTCAGGCTTTCAGAGGG + Intronic
1171979785 20:31619532-31619554 CTGTGGGTCAGGGATTAAAGTGG - Intergenic
1172740630 20:37163824-37163846 CACTGGGTAAGGACTTCAGATGG - Intronic
1172809859 20:37639667-37639689 CTGTGGATCAGGGATTCAGAAGG + Intergenic
1173191911 20:40883275-40883297 CTCTGGGCCAGGAATCCAGCCGG - Intergenic
1173317161 20:41955318-41955340 CAGTGTGTCAGGAAATCAAATGG - Intergenic
1173363095 20:42361802-42361824 CTGTGGGTCAGGAATGCAAGAGG - Intronic
1173745494 20:45433617-45433639 CTGTAGGTCTGGAATTCAGGCGG - Intergenic
1174593033 20:51661483-51661505 CTGTGGTCCCGGTATTCAGAAGG - Intronic
1174600981 20:51724624-51724646 CTGTGGGGCTGACATTCAGAAGG - Intronic
1175088710 20:56484223-56484245 CTGTAGCTGAGGAAATCAGATGG + Intronic
1175331740 20:58169303-58169325 CTGTGGGTCAGAAATCCAGATGG - Intergenic
1175518961 20:59587558-59587580 CTGTGGGTCAGGGGTGCAGGTGG + Intronic
1175547479 20:59787926-59787948 CTGTGGGTGTGTATTTCAGATGG - Intronic
1175660041 20:60804522-60804544 TTGTGGGTCAGGAAGGAAGAGGG + Intergenic
1175693682 20:61085003-61085025 CTGTGGATCAGGGATCCAGGTGG - Intergenic
1175749245 20:61483816-61483838 CTGTGGGTCAGCAATTTCGACGG - Intronic
1175809343 20:61849426-61849448 CTGTAGGTCAGAAGTCCAGATGG + Intronic
1177213771 21:18103517-18103539 TTTTGGGTCAGGAATTCAAATGG + Intronic
1177272104 21:18862682-18862704 ACGTGGGGCTGGAATTCAGAAGG - Intergenic
1178257181 21:31064825-31064847 CTGTGGGTCAGGAATTCACAAGG - Intergenic
1178542882 21:33469883-33469905 TTATGGGTCAGGAATTTGGAAGG - Intronic
1180572039 22:16734219-16734241 CTGAGGGTCAGGAGTATAGATGG + Intergenic
1181315235 22:21966758-21966780 CTGTCTGTCTGGAATGCAGAAGG - Intronic
1181764940 22:25084654-25084676 CTGTGGGTCAGAAATTAGGCAGG + Intronic
1182534974 22:30994208-30994230 CTGTGGGTCAGGAATTGGGCAGG + Intergenic
1183397861 22:37583177-37583199 CTTTGGGGCAGGAATCCAGGTGG - Intergenic
1184393580 22:44219566-44219588 CTGTGGTTAAGGAATCCAGCCGG + Intergenic
1184804556 22:46785119-46785141 TTGTGGGTCAGAAATTCACATGG + Intronic
1185363261 22:50422231-50422253 CTGTGGATGAGGAAAGCAGATGG - Intronic
950176353 3:10877575-10877597 CTGAGAGTCTGGAAGTCAGAGGG - Intronic
950883769 3:16345216-16345238 CTGTGGGCCAGAAATCCAGGTGG - Intronic
950987921 3:17395666-17395688 CTATTGGTCAGCATTTCAGAGGG + Intronic
951252202 3:20406973-20406995 CTGTGGGTCAGAAATTTGAATGG - Intergenic
954852518 3:53615657-53615679 ATGTGGGTCCAGAATTCAAAGGG - Intronic
955798466 3:62662060-62662082 CTATGTGTCTGGAACTCAGAAGG + Intronic
956772428 3:72537793-72537815 GTCTGGGTTAGGAATCCAGAAGG + Intergenic
957106153 3:75890188-75890210 CTGAGGGTCAGGAGTGTAGATGG - Intergenic
957252713 3:77794233-77794255 CTGTGGGTCAGGAATTTAGGGGG - Intergenic
960966760 3:123110933-123110955 TTGTGCCTCAGGACTTCAGACGG + Exonic
961996989 3:131256653-131256675 CTGTAGGTCATGAATTTAGGAGG + Intronic
962006659 3:131356515-131356537 CTGTAGGTCAGGAATTAAAAGGG - Intergenic
962769386 3:138598469-138598491 CTGTGGGTCAGGAATACAGTAGG + Intergenic
963810743 3:149774010-149774032 ATGTAGGTCAGTAACTCAGAGGG + Intronic
963933974 3:151033942-151033964 CTGTGGATCAGGTTTGCAGAGGG - Intergenic
966030856 3:175346211-175346233 CTGTGTGGCAGAATTTCAGAAGG - Intronic
968347405 3:198021525-198021547 CTTTCAGTCAGGAATTCAGTTGG + Exonic
968976692 4:3825790-3825812 CTGTGGGGCAGAAATTCAGGAGG - Intergenic
969059642 4:4424725-4424747 CAGGGAGTCAGGAATGCAGAAGG - Intronic
970460252 4:16268093-16268115 CTGTGGGTCACTAATCCAGAAGG + Intergenic
970569615 4:17366853-17366875 CTATGGGTCAGGAACCCAGGCGG - Intergenic
970891439 4:21049311-21049333 CTGTGGGTCAAGGATTTGGAGGG - Intronic
972664013 4:41146370-41146392 CTGTGGTCCAGCTATTCAGAAGG + Intronic
975495812 4:75034968-75034990 CTGAAGTTCAGGACTTCAGAGGG - Intronic
976388641 4:84486845-84486867 CTATGGGTCAGGAATCCCGGAGG + Intergenic
977053067 4:92154274-92154296 CTGTGGTCCAGCAACTCAGAAGG - Intergenic
977182443 4:93893642-93893664 TTGTGGATCAGAAATTCTGAAGG + Intergenic
977570115 4:98620462-98620484 CTGCAGGTCAGGAATAGAGACGG - Intronic
977938814 4:102835879-102835901 CTGTGGGTTAAGAAGACAGAGGG - Intronic
978972972 4:114833039-114833061 CTGTGGGTCAGGAATTAGACAGG - Intronic
979367568 4:119843726-119843748 GTGTGGGCCAGGAAGTTAGATGG + Intergenic
979721856 4:123909647-123909669 CTGTGGCTCAGGAATTTGGAAGG + Intergenic
980380735 4:132011751-132011773 CTGAAGGTCAGAAATTCAGATGG - Intergenic
981675532 4:147339004-147339026 CTGTAGGTCAGGAATTTGGGAGG + Intergenic
982556461 4:156872517-156872539 ATGTGCATCAGGCATTCAGATGG - Intronic
983071527 4:163273543-163273565 CTATGTGTTAGGAATTCAGATGG + Intergenic
983399628 4:167246406-167246428 CTGTGGGTCAGGAATTCAGGAGG - Intergenic
983547297 4:168977633-168977655 GTATGGGTCAGAAACTCAGAGGG - Intronic
985347587 4:189022900-189022922 CTGTGGATCAGGAATTCTGGTGG - Intergenic
985901291 5:2796729-2796751 CTGTGGGTCAGGATTTAGGATGG + Intergenic
986526866 5:8688445-8688467 CTGGGGGTCAGGAGCTCAGCTGG + Intergenic
987053248 5:14166113-14166135 TTGTGGGGCAGGAATTTAGGGGG + Intronic
988687537 5:33539581-33539603 CTGTGGGTCTTGAGTTGAGAAGG - Intronic
989001265 5:36762999-36763021 CTGTGCATCAGGAACACAGATGG + Intergenic
990006686 5:50953001-50953023 CTGTTGTCCAGCAATTCAGAAGG + Intergenic
990123407 5:52484193-52484215 CTGTAGGTCAGAAATGCAGGAGG - Intergenic
991925840 5:71704227-71704249 CTGTGGGTCAGGGCTGCTGATGG - Intergenic
992022731 5:72640261-72640283 CTATGGGGCAGAAATTCAGATGG + Intergenic
992052571 5:72955339-72955361 CTATGGGTCAGGAAGTCCGTCGG + Intergenic
992070495 5:73144308-73144330 CTGTGGGTCAGCAATTCTAGTGG + Intergenic
992397406 5:76380574-76380596 CTGTGGCTCTGGGAGTCAGAGGG + Intergenic
993021364 5:82595458-82595480 CTATAGGCCAGGAATTCAGGTGG + Intergenic
993168769 5:84388696-84388718 CTGTAGGTCAGAATTTGAGATGG - Intergenic
993843098 5:92905587-92905609 CTGTGGGTCAAAAATTTGGACGG + Intergenic
994104637 5:95933201-95933223 CTGGGGGTGGGGGATTCAGATGG + Intronic
994730707 5:103487501-103487523 CTCTGGGGCAGGGATACAGATGG + Intergenic
994841074 5:104925827-104925849 CCGTGGGTTAGGACTTTAGAAGG - Intergenic
996315734 5:122158730-122158752 CTATGAGTCTGGAACTCAGAAGG + Intronic
996907967 5:128623448-128623470 CTGTAGGTAAGCAATTAAGAAGG - Intronic
997255426 5:132424636-132424658 CTCTGGGTCAGGAATTGTGTTGG - Intronic
997296083 5:132769375-132769397 CTGTGTGCCAGGAACTGAGATGG + Intronic
997921418 5:137982755-137982777 CTGTGGGTCTTGATTTCTGAAGG + Intronic
998078530 5:139255860-139255882 CTGAGGGTCAGGAATTCAGGAGG - Intronic
998432795 5:142080941-142080963 CTATGGGTCAGGAAAGCAGATGG + Intergenic
998533570 5:142908270-142908292 CTGTGGGTCACGAATTCAGGGGG + Intronic
999247964 5:150165490-150165512 CTCTGGGTCAGGAAGTCAGATGG - Intergenic
1002050115 5:176565769-176565791 CTGTGGGTCAGGACCTGACATGG - Intronic
1003166880 6:3687352-3687374 CTGTGAGTCAAGAATCCAGGAGG + Intergenic
1003489658 6:6610383-6610405 CTGTGGGTCATAAAGGCAGAGGG - Intronic
1003992119 6:11496656-11496678 CTATGGGCCAGGAATTCAGAAGG + Intergenic
1004320989 6:14631296-14631318 CTGTGGGTCAGGCATTCAGCAGG + Intergenic
1005200488 6:23339230-23339252 CTATGGGTCAGAAATCCAGGAGG + Intergenic
1005347274 6:24903010-24903032 CAGTGAGTCAGGAATTGGGAAGG + Intronic
1005799024 6:29400303-29400325 CTGTGGGTCAGAAATTGGGGAGG + Intronic
1006313052 6:33274889-33274911 CTTTGGTTCATGAGTTCAGATGG + Intronic
1006881451 6:37343574-37343596 CTGTGGGTCAGGGATTCAGGTGG + Intergenic
1007560209 6:42801452-42801474 CTGTGGGCTAGGAATGCAAACGG + Intronic
1008116050 6:47551673-47551695 CTGTGAGTCAAGAATTCAGATGG + Intronic
1012758349 6:103263126-103263148 CACTGGGTTAGGAAGTCAGAAGG + Intergenic
1013130812 6:107230906-107230928 CTGTAGGTTAAGAATTCAGGAGG + Intronic
1013905614 6:115214069-115214091 CCAATGGTCAGGAATTCAGATGG + Intergenic
1014579872 6:123123786-123123808 CTGTGGTTCAGGAATTCAAATGG - Intergenic
1016340319 6:143054920-143054942 CTGTGGGTAAGACATTCACAGGG + Intergenic
1017835547 6:158174163-158174185 CTGTGAGATAGGAATTCAGCAGG - Intronic
1018467088 6:164057819-164057841 ATGTGGGGCAGGAAATCAGCAGG - Intergenic
1019951684 7:4378310-4378332 CTGTGGGTCATGAATTCAGGAGG + Intergenic
1021142726 7:17047676-17047698 TTGTGGGTCAGGGAGGCAGAAGG - Intergenic
1021490609 7:21216207-21216229 CTGGGTGTCAGGATTTCAGATGG + Intergenic
1022088108 7:27088271-27088293 CGTTGGGTCAAGAACTCAGAGGG + Intergenic
1024996434 7:55276161-55276183 TTGTGGGTCAGGAATTCAGGAGG - Intergenic
1026085244 7:67257956-67257978 CTGTGACTCAGTAAATCAGAGGG + Intergenic
1026385218 7:69840032-69840054 CAGTGAGTCAGGAACTCTGATGG + Intronic
1026691927 7:72556938-72556960 CTGTGACTCAGTAAATCAGAGGG - Intergenic
1028098738 7:86794549-86794571 CTGAGGATCAGGCATTGAGAAGG + Intronic
1028451847 7:90994133-90994155 TTCAGGGTCAGGAATTCAGTAGG + Intronic
1028513460 7:91650482-91650504 GTGTGGGTTAGGAATGAAGATGG - Intergenic
1029359159 7:100075686-100075708 CTGTGGGTTGGGAAGTCAGCAGG - Intronic
1030275935 7:107721809-107721831 CTTTGGGGTAGGAATGCAGATGG - Intergenic
1030541854 7:110840345-110840367 ATATGGGTCAGGATTCCAGAAGG - Intronic
1031454737 7:121965172-121965194 CTGTGGGTCAGGAGCTGAGGAGG + Intronic
1032435803 7:131899443-131899465 AGGTGAGTCAGGAATTCAGACGG - Intergenic
1034282947 7:149866195-149866217 CTGTGGGTCTGGCGGTCAGAGGG + Exonic
1034526632 7:151667875-151667897 CTGTGGGTCAGCAATTTGGGTGG - Intronic
1034661205 7:152771564-152771586 CTGTGGGAGAAGAATCCAGAAGG + Intronic
1035047706 7:155980171-155980193 CACTGGGTTAGGAAGTCAGAAGG + Intergenic
1035100152 7:156389651-156389673 CGGTGGATCAGAAATTCAGGAGG + Intergenic
1037123527 8:15317828-15317850 GTATGTGTCAGGATTTCAGAAGG + Intergenic
1037557909 8:20043392-20043414 TTGTAGGTGAGGAATTCAAATGG + Intergenic
1038432098 8:27508573-27508595 CTGTGGCTCAGGTATGCTGAGGG - Intronic
1038514057 8:28169345-28169367 CTGTGGGTCAGAAATTCAGCAGG + Intronic
1038710907 8:29944442-29944464 CTGTGCTGCAGGCATTCAGAGGG + Intergenic
1039136626 8:34331069-34331091 TTGTGGGTCAGGAATCAAGAAGG - Intergenic
1040365695 8:46712901-46712923 CTGTTGTTCAGTAACTCAGATGG - Intergenic
1041016575 8:53597590-53597612 CAGTGGGACAGGAATTCTGGAGG - Intergenic
1041830861 8:62151743-62151765 TTGTGGGTCAGGAATTTGGCAGG + Intergenic
1042303220 8:67308207-67308229 CTGTGTGTCAGGAATTCAGATGG - Intronic
1044237284 8:89845579-89845601 CTGTGGGTCGGGAATTTGAAAGG - Intergenic
1045477654 8:102567004-102567026 CTGTAGGTCAGAAATTCAGATGG + Intergenic
1045517390 8:102872170-102872192 CTGTAGGTCAGAAGTTCAGGAGG - Intronic
1046500551 8:115070858-115070880 CTGCGGGTCAAGCAGTCAGAAGG - Intergenic
1046516443 8:115267916-115267938 CTGTGGGTCAGTAATTCAGGAGG - Intergenic
1046895747 8:119470525-119470547 CTGTGAATAAGGAATTTAGAAGG - Intergenic
1047249627 8:123171887-123171909 CAGAAGCTCAGGAATTCAGAAGG - Intergenic
1047513387 8:125532487-125532509 CTGTGGGTCAGGAATCTGGGTGG + Intergenic
1047520655 8:125593176-125593198 CTAGGGGTCAGCAATGCAGAAGG + Intergenic
1048425475 8:134319372-134319394 CTGAGGGTGAGGAATTGAGATGG - Intergenic
1048457064 8:134587782-134587804 CTATGGAGAAGGAATTCAGAAGG - Intronic
1049315244 8:141962663-141962685 CTGGGGCTCAGGAATGCAGGGGG + Intergenic
1049376589 8:142292266-142292288 CTGTGGGTCAGAACTTCCAACGG - Intronic
1050877085 9:10651819-10651841 CAGTGGGTCAGGCTTTCAGGTGG - Intergenic
1051933636 9:22416775-22416797 CTTTCACTCAGGAATTCAGATGG - Intergenic
1052588434 9:30459189-30459211 CTATGGGTCAGGAATAAGGAAGG + Intergenic
1052774984 9:32724169-32724191 CTGTGGATCAGGAATGCGGGTGG + Intergenic
1054764414 9:69031577-69031599 CTGTGGGCCTGAAATTCACATGG + Intergenic
1055407450 9:75989526-75989548 CTGAGGGTCAGGAATTCAGACGG + Intronic
1056592186 9:87972741-87972763 CAGTTGGTCAGCAATTCTGAAGG - Intronic
1056958797 9:91103768-91103790 CAGTGGGTTGGGAATTCAGACGG - Intergenic
1057146149 9:92760697-92760719 CTGTGCTTCAGGTATTCACAGGG + Intronic
1057307435 9:93920459-93920481 CTGGGGGTCAGGAGTGAAGAAGG + Intergenic
1058435655 9:104960865-104960887 CTGTGGTCCAGGAATAGAGAGGG - Intergenic
1059463262 9:114448861-114448883 CTGTGGGTGAGGAAGTGACAAGG - Intronic
1059759003 9:117320736-117320758 CTGTAGGTAAGGAAATCAAAGGG - Intronic
1061530373 9:131207275-131207297 CTGTAGGTCATAACTTCAGATGG + Intronic
1062406445 9:136399075-136399097 CTGTGGTCCAGGAAGTCTGAAGG + Intergenic
1062703116 9:137918435-137918457 CTGTGGGTCAGGAATCTGGGAGG + Intronic
1185943513 X:4347978-4348000 ATCTGGCTCAGGAATCCAGATGG + Intergenic
1186050846 X:5593318-5593340 CTGTGGGTCAGGAAATCCAGAGG - Intergenic
1186390369 X:9152595-9152617 GTGTGGTTCAGGAATCCACATGG - Intronic
1187089078 X:16075233-16075255 TAATAGGTCAGGAATTCAGATGG + Intergenic
1187289426 X:17939027-17939049 CTGTGAGCCAGGTATTCAGGCGG + Intergenic
1187340736 X:18419408-18419430 CTGAGTGTCAGGAATTCAGGAGG + Intergenic
1187391359 X:18888436-18888458 CTGTGTGTCAGGAGTGAAGAGGG - Intergenic
1187572775 X:20521676-20521698 CAGTGGGTCAGGAATTCAGGTGG + Intergenic
1189205953 X:39238991-39239013 CCATGGGTCAAGAATTCAGATGG + Intergenic
1189672334 X:43424357-43424379 CTGTGGGTCAGGGGTTCATATGG - Intergenic
1190065681 X:47240364-47240386 CTTTGGGCCAAGAACTCAGAAGG + Exonic
1190148663 X:47921891-47921913 CTATGGGTCAGGAATTCGTATGG - Exonic
1190655118 X:52604992-52605014 CTGTGTGTCAGGAATTAGGAAGG - Intergenic
1191800836 X:65077479-65077501 TTGTGGATCAGGAGTTAAGATGG + Intergenic
1192102220 X:68277030-68277052 TTTTGGGTTAGGCATTCAGACGG - Intronic
1192630004 X:72769880-72769902 CTTTGGGTCAGCAAATAAGAGGG - Intergenic
1192651706 X:72950924-72950946 CTTTGGGTCAGCAAATAAGAGGG + Intergenic
1195501732 X:105609638-105609660 CTGTGAGTCAGGAATAGATACGG + Intronic
1197858501 X:130945262-130945284 CTGAGGGTTAGGAATTCAGGAGG + Intergenic
1198219397 X:134585892-134585914 CTGTGACTCAGGAAGTCAGCAGG - Intronic
1199860750 X:151798734-151798756 CTGTGTGTCTGGAATTAGGAGGG + Intergenic
1200919604 Y:8601547-8601569 CTGTCGGGCATGGATTCAGAAGG + Intergenic