ID: 947131737

View in Genome Browser
Species Human (GRCh38)
Location 2:226933787-226933809
Sequence CTACATCCCAAGAGGAAGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 162}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947131733_947131737 -9 Left 947131733 2:226933773-226933795 CCCTTTCCAGCTTTCTACATCCC 0: 1
1: 0
2: 6
3: 47
4: 737
Right 947131737 2:226933787-226933809 CTACATCCCAAGAGGAAGCTAGG 0: 1
1: 0
2: 1
3: 18
4: 162
947131734_947131737 -10 Left 947131734 2:226933774-226933796 CCTTTCCAGCTTTCTACATCCCA 0: 1
1: 0
2: 2
3: 32
4: 361
Right 947131737 2:226933787-226933809 CTACATCCCAAGAGGAAGCTAGG 0: 1
1: 0
2: 1
3: 18
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947131737 Original CRISPR CTACATCCCAAGAGGAAGCT AGG Intronic
900661779 1:3788287-3788309 CTCCAGCCCTAGAGGAAGCTGGG - Intronic
901396475 1:8985670-8985692 AAACATCCCAAGAGCTAGCTCGG - Intergenic
902303176 1:15517532-15517554 ATAAATCCCAAGAGTAAGCTGGG - Intronic
902816998 1:18922249-18922271 CTCCCTCCCTGGAGGAAGCTGGG + Intronic
904136112 1:28313881-28313903 CTATTTCTCAAGAGGCAGCTTGG - Intergenic
904626665 1:31809950-31809972 CTGCATTGCAAGAGGCAGCTTGG - Intronic
905149289 1:35914540-35914562 CTACATCCCAAAAGCAGGCATGG - Intronic
905456971 1:38094965-38094987 CTGCATCCCCAGAGGAGGCTGGG + Intergenic
905645284 1:39620971-39620993 TTGCATCCCAAGGGGAAGCCTGG + Intergenic
905695851 1:39972998-39973020 CTAAATCCCCATAGGAAGTTTGG - Intergenic
905938106 1:41840760-41840782 CGACATAACCAGAGGAAGCTTGG + Intronic
907153539 1:52310979-52311001 CTTCATCCCCTGAAGAAGCTGGG + Intronic
908782810 1:67707013-67707035 CTAAATCCCAAGAGAGAACTAGG - Intronic
910176640 1:84437937-84437959 CTTCATCCCAAGAGCACTCTGGG - Intergenic
910713020 1:90201257-90201279 CTTCAGCCCAAGGGCAAGCTCGG + Intergenic
911635914 1:100236212-100236234 CTCCATCTCCTGAGGAAGCTGGG + Intronic
917371480 1:174298425-174298447 CTTTATCCAAATAGGAAGCTTGG + Intronic
917680727 1:177364195-177364217 CTACATTTTAAGAGGAAACTAGG + Intergenic
923814171 1:237357233-237357255 CTATAGCCAAAGAGGAAGGTAGG - Intronic
924076171 1:240339448-240339470 CTAGATCCCCAGTGGATGCTTGG - Intronic
1062984180 10:1752203-1752225 CTCCATGCAAAGAGGAAGGTTGG + Intergenic
1063775961 10:9264439-9264461 CTACATCACTAGAGGAAGGTCGG + Intergenic
1065650537 10:27884745-27884767 TAAGATCCCAAGAAGAAGCTGGG + Intronic
1065906361 10:30256139-30256161 CTACACCCTAAGTGGAAGCTGGG + Intergenic
1067804295 10:49382456-49382478 CTGCATCCCCAGAGGTAGCTGGG - Intronic
1071604981 10:86979716-86979738 CTGCATCCCAAAAGTAAGATGGG - Intronic
1073347986 10:102799028-102799050 CTAAATCCCATGTGGAGGCTGGG + Intronic
1074963502 10:118468928-118468950 CTTCATGCCAAGAGGAACATGGG + Intergenic
1076384076 10:130044772-130044794 GTACATCCCCAGAGGAAGTCTGG - Intergenic
1077382461 11:2250525-2250547 CTATGTCCTAAGTGGAAGCTGGG - Intergenic
1086121318 11:83307023-83307045 CTGCATCCAAAAGGGAAGCTGGG + Intergenic
1087497015 11:98904451-98904473 ATAAATCCCAAGATGGAGCTGGG + Intergenic
1089356194 11:117855559-117855581 CTCCTTCCAGAGAGGAAGCTGGG + Intronic
1090230060 11:125095941-125095963 CTGCAGCCCAAGTGGAAGCTTGG - Intergenic
1090911263 11:131121632-131121654 CTACATGGGAAGATGAAGCTGGG + Intergenic
1094825297 12:34264793-34264815 CCACTTCCCCAGAGGCAGCTTGG + Intergenic
1095085262 12:38053312-38053334 CCACTTCCCCAGAGGCAGCTTGG - Intergenic
1095946646 12:47757757-47757779 GTACACCCCCAGAGCAAGCTGGG + Intronic
1096119102 12:49075332-49075354 CTGCCACCCAAGAAGAAGCTCGG - Intergenic
1100109543 12:91222557-91222579 CTACATCTCTAAAGAAAGCTCGG + Intergenic
1103258735 12:119565812-119565834 CTCCATCCCAGGAGGATGCATGG + Intergenic
1103687576 12:122744244-122744266 CTACAGCCCAGGAGAAGGCTGGG + Intergenic
1104078934 12:125413443-125413465 CGTCATCCCAAAAGGAAACTGGG + Intronic
1104135779 12:125936684-125936706 CTGCAACCCAGGAGGCAGCTGGG + Intergenic
1104423744 12:128657932-128657954 CTACAACCCTAGAGGAAACTGGG + Intronic
1104528466 12:129547072-129547094 CTAGAGCCCCAGAGGAAGCAAGG - Intronic
1105822040 13:24088413-24088435 CTTCATCTCAAGAGGAAGAAAGG - Intronic
1105986244 13:25570542-25570564 CTGCATTCCAAGAGAAACCTGGG + Intronic
1106367777 13:29099759-29099781 CTACAGCACGTGAGGAAGCTTGG + Intronic
1106688463 13:32087577-32087599 TAAAATCACAAGAGGAAGCTGGG - Intronic
1106801842 13:33263999-33264021 CTGCATCCCAAGAGTGAGCAAGG - Intronic
1107964131 13:45584560-45584582 CCAGATCCCCAGAGGATGCTTGG - Intronic
1108721426 13:53136745-53136767 CAACAGTCCATGAGGAAGCTGGG - Intergenic
1108978269 13:56477475-56477497 CTACATCCCAAGCAGAAGGGAGG - Intergenic
1109974294 13:69810902-69810924 CTACCTCCCAAGACTGAGCTAGG + Intronic
1112919260 13:104590814-104590836 TTACTGCCCAAGAGGAAGCTGGG - Intergenic
1113992985 14:16042735-16042757 CCACTTCCCCAGAGGCAGCTTGG + Intergenic
1114069182 14:19094659-19094681 CTGCATCCCCAGAGTAAGATGGG + Intergenic
1114093078 14:19305344-19305366 CTGCATCCCCAGAGTAAGGTGGG - Intergenic
1117316267 14:54573836-54573858 CTACATCCCAAGAGCCAGCTTGG + Intronic
1123933067 15:25181177-25181199 CTCCATCCCCAGAGAAAGGTGGG + Intergenic
1128442731 15:67727911-67727933 AAACCTCCCAAGAGCAAGCTGGG - Exonic
1129936659 15:79456670-79456692 CTAACTCCCAACAGGAAGTTAGG - Exonic
1130668567 15:85890478-85890500 CTCCATCCTGAGAGGGAGCTGGG + Intergenic
1132361766 15:101222243-101222265 CTCCATGCCAAGGGGAAACTAGG - Intronic
1134301808 16:12998399-12998421 CTACATACCAAAAGGAGGCTGGG - Intronic
1134911848 16:18034522-18034544 CCAAATACCAAAAGGAAGCTGGG + Intergenic
1136912352 16:34154487-34154509 CCACTTCCCCAGAGGCAGCTTGG + Intergenic
1137569103 16:49553030-49553052 CAGCATCCCAGGAGAAAGCTGGG - Intronic
1141990411 16:87606029-87606051 CCCCTTCCCAACAGGAAGCTGGG - Intronic
1143599336 17:7933652-7933674 CTTGATCCCAAGAGGGAGCTAGG + Intronic
1144888335 17:18478705-18478727 CTTCCTCTCATGAGGAAGCTCGG - Intronic
1145002054 17:19312512-19312534 CTACATCACAGCAGGAAGCCTGG - Intronic
1145143871 17:20465597-20465619 CTTCCTCTCATGAGGAAGCTCGG + Intronic
1146161942 17:30564824-30564846 CCACATCACAGGAGGCAGCTGGG + Intergenic
1148083119 17:44978322-44978344 CTGGATCCCAAGAGTAAGATAGG + Intergenic
1149527058 17:57364765-57364787 CTCAATCCCAAAAGGGAGCTTGG - Intronic
1150454649 17:65297501-65297523 CTAGAGCCCAAAAGAAAGCTGGG + Intergenic
1151014157 17:70535022-70535044 ATACATACCAGGTGGAAGCTAGG + Intergenic
1151879326 17:76885625-76885647 CTATTTCCCAGGAGGGAGCTGGG - Intronic
1154325771 18:13389452-13389474 CCACACCCCAGGAGGCAGCTGGG + Intronic
1154341880 18:13510303-13510325 CTAAATCCCAGGAGTCAGCTTGG + Intronic
1155128215 18:22901774-22901796 CTACAAACCAAGAAGAAGCCTGG + Intronic
1155951732 18:31921000-31921022 CTACACCTCAAGAGAATGCTGGG - Intronic
1160627399 18:80220330-80220352 CTACAACTCAAGATGAAACTTGG + Intronic
1161464714 19:4422505-4422527 CCAACTCCCAGGAGGAAGCTCGG - Intronic
1164923190 19:32104985-32105007 CCACTTACCACGAGGAAGCTCGG - Intergenic
1167383873 19:49153034-49153056 CCACACCCCAAGATGCAGCTTGG + Intronic
1167851744 19:52207516-52207538 CTGCTTCCCAAAAGGAAGCGTGG - Intronic
1168138686 19:54369877-54369899 CCACATCTCAGGAGGAAGATAGG - Intronic
1168159342 19:54498620-54498642 CCACATCTCAGGAGGAAGATAGG + Intronic
925167229 2:1723999-1724021 CTTATTCCCAAAAGGAAGCTTGG + Intronic
932321856 2:70828355-70828377 CTTCCTCCCTTGAGGAAGCTGGG - Intergenic
935030698 2:99318674-99318696 CTTCATCCTATGAGTAAGCTGGG + Intronic
937730957 2:125228363-125228385 GAACTTCCAAAGAGGAAGCTGGG + Intergenic
938538717 2:132268147-132268169 CCACTTCCCCAGAGGCAGCTTGG - Intergenic
938621121 2:133054464-133054486 CAACATGCCAAGAGGGAGCCTGG + Intronic
938728254 2:134125720-134125742 CCACATTCCAAGGTGAAGCTGGG - Intronic
943812669 2:192209060-192209082 CTGCATCCTCAGAGGTAGCTTGG - Intergenic
946460109 2:219861370-219861392 CTGCATCCCCAGAGGACTCTGGG - Intergenic
947131737 2:226933787-226933809 CTACATCCCAAGAGGAAGCTAGG + Intronic
1169570513 20:6900453-6900475 CCACTTACTAAGAGGAAGCTCGG - Intergenic
1170123201 20:12934109-12934131 CAACATCCCAAGAGAAATCTAGG - Intergenic
1170397373 20:15941777-15941799 CTAAAGCCCAAGAAGATGCTTGG - Intronic
1171867632 20:30500110-30500132 CCACTTCCCCAGAGGCAGCTTGG - Intergenic
1171907636 20:30912634-30912656 CCACTTCCCCAGAGGCAGCTTGG + Intergenic
1172798411 20:37559286-37559308 CTGCAACTCCAGAGGAAGCTAGG - Intergenic
1173128640 20:40365433-40365455 CTAAATGGCAAAAGGAAGCTAGG + Intergenic
1174618167 20:51852448-51852470 TTAGATCACAAGAGCAAGCTGGG - Intergenic
1175468777 20:59210802-59210824 CTAAATCCCAAGAGCAAACTGGG + Intronic
1178108853 21:29350635-29350657 GCACATCCCAAGAGGAAGAATGG + Intronic
1178398017 21:32259634-32259656 GCACATCCCAAGAGGAGACTTGG - Intergenic
1178755185 21:35342742-35342764 CTGCATTTCAAGGGGAAGCTTGG - Intronic
1179278027 21:39909549-39909571 CCACATCCCAAGAGGAAAAAAGG - Intronic
1179289098 21:40003232-40003254 CCACATCCTAGCAGGAAGCTGGG + Intergenic
1179419723 21:41225809-41225831 CCACATGCCAGGAGGAGGCTGGG + Intronic
1180314283 22:11264784-11264806 CCACTTCCCCAGAGGCAGCTTGG - Intergenic
1180341075 22:11618767-11618789 CCACTTCCCCAGAGGCAGCTTGG + Intergenic
1180487655 22:15817222-15817244 CTGCATCCCCAGAGTAAGATGGG + Intergenic
1184119627 22:42441382-42441404 CCTCATCCCAAGAGGAAGGAAGG - Intergenic
1184210834 22:43034758-43034780 CAACCTCCCAAGAAGTAGCTGGG - Intergenic
953098746 3:39805620-39805642 CTACCTACCAATAGGAAACTGGG + Intergenic
955312970 3:57908547-57908569 TTACATCCCAGGAGGGAACTAGG + Intronic
955885796 3:63596667-63596689 CTACAGGCCAAGAGGAATGTGGG + Intronic
957136582 3:76296244-76296266 CTAAAGCCCCAGAGAAAGCTTGG + Intronic
961914329 3:130355938-130355960 ATACTACCCAAGAGGAAGCAGGG + Intronic
968260089 3:197314558-197314580 CAACCTCCCAAGATTAAGCTAGG - Intergenic
969841262 4:9884038-9884060 CCACAGCCCAGGAGGAAACTGGG + Intronic
971223425 4:24730108-24730130 CTGCATGCAAAGAGAAAGCTCGG - Intergenic
974067602 4:57094319-57094341 CTACTTGCCAAGTGGAAACTGGG + Intronic
984082618 4:175266983-175267005 TTACATCCCAAGAAGAGGTTTGG - Intergenic
987448926 5:18056987-18057009 CTGTATCCCAAGTGAAAGCTGGG + Intergenic
988219248 5:28320154-28320176 CTCCCTCCCAAGAGGAGGATTGG + Intergenic
988393264 5:30663376-30663398 CACCATCCCAAGGGGATGCTGGG - Intergenic
990854629 5:60250331-60250353 ATACATCTCTAGAGGCAGCTAGG + Intronic
995090109 5:108164408-108164430 CTACAGCCTAAGAAGAGGCTTGG - Intronic
995453755 5:112331162-112331184 CTCCATTAGAAGAGGAAGCTGGG - Intronic
995892045 5:116965317-116965339 CTACATCCCCAGAGAAAACAGGG + Intergenic
996826867 5:127692782-127692804 CTACATCTCAGGAAGAAGATGGG + Intergenic
999393803 5:151213882-151213904 CTACATGCTCAGAGGAAGCCAGG - Intronic
999504799 5:152183625-152183647 CTACTTCCCAATAAGAACCTTGG + Intergenic
1003128304 6:3373592-3373614 CTAAATCAAAAGAAGAAGCTGGG + Intronic
1003783537 6:9456751-9456773 AGACATCTCAAGAGGAAGCAGGG + Intergenic
1004182994 6:13396975-13396997 TTACCTCCCAGGAGGAAGGTAGG + Intronic
1006629161 6:35418913-35418935 CTAGGACCCAAGGGGAAGCTGGG + Intronic
1008230306 6:48978935-48978957 CTACATCCCCACTGGAAACTGGG - Intergenic
1009727562 6:67555072-67555094 CTCCATCCCAAGACTAAACTAGG - Intergenic
1011993362 6:93552310-93552332 CTACATCCCAAGAGGGAAGCAGG - Intergenic
1013268882 6:108527436-108527458 CTACTACCCATGAGGAAACTGGG + Intergenic
1017488620 6:154924949-154924971 CCAGGTCCCAAGAGGAAGGTGGG + Intronic
1019788791 7:2996989-2997011 CTCCATCCCATGGGGAGGCTGGG - Intronic
1020427764 7:8089236-8089258 TTAAATGCCAAGAGGAAGCCAGG - Intronic
1024472885 7:49781945-49781967 CTAGATCCCAAGAGGCAGGTAGG + Intronic
1026557576 7:71421591-71421613 CCATATCCCGAGAGGCAGCTGGG - Intronic
1028752972 7:94403087-94403109 CTACATCTCAAGAAGAAGCAAGG + Intronic
1028776124 7:94678766-94678788 CTACCTCCCAAGATGAAACCAGG - Intergenic
1032576599 7:133061123-133061145 CTGCATCCTAAGAGGAAGGCCGG + Intronic
1035620098 8:1029968-1029990 GCTCATCCCGAGAGGAAGCTGGG + Intergenic
1037250226 8:16884549-16884571 CTTCATCCCAAGAGTCACCTTGG + Intergenic
1044287620 8:90427530-90427552 CTAAATCCCAAAATGAACCTGGG - Intergenic
1044584776 8:93859281-93859303 CTGGATCCCAAGGGGAAGCATGG + Intronic
1046374782 8:113362820-113362842 CTAAATCCCAAGAAGAATATGGG - Intronic
1047774917 8:128062068-128062090 CTACATCTCAATAGGGAGCCTGG + Intergenic
1048822206 8:138391009-138391031 CTACTTCCCAAGATGAAGAATGG + Intronic
1049620506 8:143596351-143596373 CTACTTCCTCAGAGGACGCTCGG + Intronic
1052392632 9:27898736-27898758 CTACAACCCAAGAGTTACCTGGG - Intergenic
1054874150 9:70077718-70077740 GAACATCCAAAGAGGAAGCAAGG - Intronic
1055595682 9:77862485-77862507 CCACATCCCAAGTGGTACCTTGG + Intronic
1055751585 9:79512555-79512577 CTAGATTGCAAGAGGGAGCTAGG - Intergenic
1058140824 9:101355354-101355376 CTGTATCAAAAGAGGAAGCTTGG - Intergenic
1059335960 9:113568639-113568661 CTGCAGCCCAAGCCGAAGCTGGG + Intronic
1061810325 9:133158790-133158812 CATCATCCCAAAAGGAAGCTCGG + Intronic
1203362595 Un_KI270442v1:230906-230928 CTACTTCCCCAGAGGCAGCTTGG - Intergenic
1189473066 X:41329271-41329293 CTACTACCTAAGAGGCAGCTCGG + Intergenic
1192070610 X:67936592-67936614 CTTAATCCCAGGATGAAGCTGGG + Intergenic
1195362583 X:104098388-104098410 GTACATGCCATGAGGAAGTTAGG + Intergenic
1195751117 X:108162741-108162763 CTTCTCCCCAACAGGAAGCTTGG + Intronic
1196398161 X:115288377-115288399 CTACAGCCCAAGAGGAGCCTGGG + Intergenic
1196898750 X:120362623-120362645 CTACCACCCAAGAGACAGCTGGG - Intronic
1199682212 X:150234219-150234241 TGACATCCCAATAGAAAGCTTGG + Intergenic
1201774315 Y:17646749-17646771 CCACTTCCCGAGAGGCAGCTTGG + Intergenic
1201827242 Y:18259240-18259262 CCACTTCCCGAGAGGCAGCTTGG - Intergenic