ID: 947131814

View in Genome Browser
Species Human (GRCh38)
Location 2:226934824-226934846
Sequence AATTATGCACAGAGGGATGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 184}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947131814_947131819 23 Left 947131814 2:226934824-226934846 CCCACATCCCTCTGTGCATAATT 0: 1
1: 0
2: 1
3: 18
4: 184
Right 947131819 2:226934870-226934892 TTTTTAAATAGCCTGCCACCAGG 0: 1
1: 0
2: 0
3: 21
4: 208

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947131814 Original CRISPR AATTATGCACAGAGGGATGT GGG (reversed) Intronic
901809282 1:11757730-11757752 AATTATGTACAGACGCATGGTGG + Intergenic
904282682 1:29432449-29432471 GGATATGCACAGAGGGCTGTGGG - Intergenic
905477968 1:38242189-38242211 AATTAGGCTCTGAGGGATGCAGG - Intergenic
906713972 1:47953215-47953237 GATGATGCACAGAGGGGTGTGGG + Intronic
909061734 1:70886625-70886647 AAAGATGCAGAGAGTGATGTGGG - Intronic
911960397 1:104295157-104295179 AATTACACACAGAAGAATGTGGG + Intergenic
914622994 1:149429791-149429813 ATTTATGCATAGAGTGGTGTGGG + Intergenic
915615539 1:157034979-157035001 AGGTGTGCAAAGAGGGATGTGGG + Intronic
917475135 1:175362884-175362906 AATAAAGCACAGATGGGTGTGGG + Intronic
919852107 1:201679795-201679817 AGTGATGCAAAGAGGGATGTGGG + Intronic
920093344 1:203469996-203470018 CAATTTGCACAGAGGGATTTAGG + Intergenic
920224938 1:204431630-204431652 CTATCTGCACAGAGGGATGTCGG - Intronic
920581088 1:207108691-207108713 AATTAGGCCCAGAGGTCTGTGGG + Intronic
921124735 1:212167344-212167366 GAATATCCACAGAGGGATGAAGG - Intergenic
924019007 1:239760742-239760764 AATTATGAACAGAGGCATCAAGG - Intronic
924035463 1:239931680-239931702 AAGTATGAACAGAAGCATGTGGG - Intergenic
924354509 1:243156938-243156960 AATTATGCACATCTGTATGTTGG - Intronic
924404437 1:243727882-243727904 ATTTAGGCATAGAGGGATGTTGG + Intronic
924604263 1:245518918-245518940 AATCATGCACAAAGGGATCCGGG - Intronic
924848465 1:247798046-247798068 AATTATGCCCAGTGGGGTGTGGG + Intergenic
1063982062 10:11462373-11462395 AATTATGAACATAGCAATGTAGG + Exonic
1065804908 10:29385209-29385231 TGTTATGCATAGAGTGATGTGGG - Intergenic
1067720925 10:48727221-48727243 AATTAGGGACAGAGGGCTGAGGG + Intronic
1068423952 10:56831996-56832018 AATTAAGCAAAGAGGAGTGTAGG - Intergenic
1070448277 10:76530283-76530305 ATTTATGCACTGAGGAATATAGG + Intronic
1070615525 10:77966765-77966787 ACTGAGGCCCAGAGGGATGTGGG + Intergenic
1072762970 10:98073014-98073036 AAAAATGGACAGAGGAATGTGGG + Intergenic
1076240883 10:128906363-128906385 AATTGTGCCTAGAGGGCTGTTGG - Intergenic
1077449765 11:2632679-2632701 AATTAGGCACAGAAAGATGGAGG - Intronic
1079310147 11:19358158-19358180 AATTAGAAAGAGAGGGATGTGGG + Intronic
1081800679 11:45856978-45857000 ACTCATGGACAGAGGGCTGTGGG + Intronic
1082765915 11:57167573-57167595 AATTCTGGACAGAGGAAAGTGGG - Intergenic
1083383290 11:62286574-62286596 AATTATGCACTCAGGGAGCTTGG - Intergenic
1084251465 11:67902711-67902733 AATTTATCACAGAGGGATGGAGG - Intergenic
1084685804 11:70694529-70694551 AATTATCCACAGTAGGCTGTGGG - Intronic
1085769848 11:79315021-79315043 AGTTATGCACAGAGGGTGGTAGG + Intronic
1086508843 11:87533549-87533571 AAATATGGCCAGAGAGATGTGGG + Intergenic
1087648393 11:100834746-100834768 AGGTATGAACAGAGGGATGGAGG + Intronic
1087765798 11:102151880-102151902 AATTATGTACAGAGTGAGGGAGG + Intronic
1088633050 11:111792621-111792643 GATTATGCACTGAGGGAGCTTGG - Intronic
1090093098 11:123716836-123716858 CAACATGCACAGAGGGCTGTGGG - Intergenic
1092283061 12:7111922-7111944 AACTATGCATGGAGGGATCTAGG + Intergenic
1092785095 12:12019342-12019364 AATTGTGCACAGAAGGTTGGGGG - Intergenic
1093389401 12:18600405-18600427 AACTATGCTCAGAGGAATATTGG + Intronic
1099909634 12:88813801-88813823 AATTAAGCAAATAGGGAGGTTGG - Intergenic
1100181323 12:92089142-92089164 AATTATGTATAGAGTGATTTAGG + Intronic
1101321252 12:103674980-103675002 AATCATCCACAGAGGACTGTCGG + Intronic
1102734483 12:115146129-115146151 AATTATGGTGAGAGGGATCTGGG - Intergenic
1103924757 12:124417406-124417428 ACATTTGCACAGAGGGAGGTGGG - Intronic
1103925765 12:124422682-124422704 AATTAAGCCCAGGGGGGTGTGGG + Intronic
1104067096 12:125315096-125315118 GCTTATGCACAGAAGGAAGTAGG + Intronic
1104308649 12:127634069-127634091 AATGCTGCACAGAAAGATGTGGG + Intergenic
1105303138 13:19152700-19152722 AATGATGCACAGACAGAGGTAGG + Intergenic
1106785834 13:33107416-33107438 GATTATGCACAGAGGGCTCTGGG + Intronic
1107294110 13:38891787-38891809 ACCTATACACAGAGGGATGGTGG + Intergenic
1107764767 13:43722348-43722370 AAATGTTCACAGAGGGATGTAGG + Intronic
1108257274 13:48622857-48622879 AATTATGCACAGACTCATATGGG + Intergenic
1109861906 13:68211153-68211175 AATTATGTAGAGAGGTAAGTAGG + Intergenic
1110452924 13:75657069-75657091 AGACATGCACAGAGGGATGAAGG + Intronic
1111543598 13:89700749-89700771 AATTCTACACAGATGGATGTGGG + Intergenic
1111764909 13:92516200-92516222 AATTATGCACTGAGTACTGTGGG + Intronic
1112362559 13:98730643-98730665 AACGATGCACTGAGGGCTGTGGG - Intronic
1113404603 13:110026678-110026700 AATGATGCAGAGAGTGAGGTGGG + Intergenic
1116220501 14:42079918-42079940 AATTAATCAAAGAGAGATGTAGG - Intergenic
1117845317 14:59905654-59905676 ATTTCTGCAAAGTGGGATGTGGG + Intergenic
1119528737 14:75344259-75344281 AACCATGACCAGAGGGATGTGGG + Intergenic
1119960382 14:78849004-78849026 AATTATGCACAGAGAAAACTTGG + Intronic
1123799937 15:23809070-23809092 CTTTATGTACAGAGTGATGTTGG + Intergenic
1124571698 15:30870328-30870350 AATTATCCACAGAGGATGGTAGG - Intergenic
1124991055 15:34674197-34674219 AAATATGCACAGGTGGCTGTGGG - Intergenic
1127300709 15:57650983-57651005 AATTATGAGCAGAGTGATGAAGG - Intronic
1127778543 15:62290250-62290272 AATTATGATCACAGGCATGTGGG + Intergenic
1131741257 15:95395160-95395182 AATTACGCACACTGAGATGTGGG + Intergenic
1132058449 15:98670259-98670281 CATTTTGCCCAGAGGGATCTTGG + Intronic
1133718872 16:8475392-8475414 TATTATGCACACAGGGAGTTGGG - Intergenic
1135245718 16:20855314-20855336 AATTAAGCACAGACGGAGCTGGG + Exonic
1138648362 16:58441858-58441880 ACTCAGGCACAGAGGGAGGTAGG + Intergenic
1139801619 16:69527466-69527488 ACTTATCCACTGAGTGATGTGGG + Intergenic
1143226155 17:5305602-5305624 AAATAAGAACAGAGGGATTTTGG + Intronic
1144151905 17:12456125-12456147 AAATATGCACATAGTCATGTGGG + Intergenic
1145807451 17:27745075-27745097 AATTTTGCTCAGAGAGATGAAGG + Intergenic
1148774949 17:50090029-50090051 AATTCTGGACAGACAGATGTTGG + Intronic
1149339835 17:55673936-55673958 AATTATGCACCCTGGGATATTGG - Intergenic
1149351763 17:55795997-55796019 AATTCTGCACAGAGGCGTCTAGG + Intronic
1149406470 17:56356957-56356979 AATTATGCACAGGGGGCTTTGGG - Intronic
1154428181 18:14288266-14288288 AATTATGGACAGGAGGTTGTTGG + Intergenic
1159239289 18:65720449-65720471 ATTTATGCAAAAAAGGATGTTGG - Intergenic
1161719460 19:5895025-5895047 ACTGATGCACAGAGGGAGGCCGG + Intronic
1161999676 19:7735382-7735404 AAGTATGCAAAGAGGTATGCAGG + Intergenic
1162806247 19:13139317-13139339 AATTATGTACAGGGGGGTGGGGG - Exonic
1163273187 19:16266514-16266536 AAAGCTGCTCAGAGGGATGTGGG - Intergenic
1164417219 19:28057353-28057375 CATTATGCACTGAGGCCTGTGGG + Intergenic
925435411 2:3833113-3833135 AAGAATGCTCAGAGGGATGCAGG - Intronic
925648945 2:6068360-6068382 GATTATGCACAGAGGGAGCAGGG - Intergenic
925872280 2:8281777-8281799 CATTATGCTCAGAGGAAGGTGGG - Intergenic
927104894 2:19815282-19815304 AAGTAGGCACAGAGAGATTTGGG + Intergenic
928418135 2:31113799-31113821 ACTCAGGCACAGAGGGAGGTGGG + Intronic
928436407 2:31257327-31257349 AAGGATGGACAGAGGGATGTAGG + Intronic
928753912 2:34501199-34501221 AATGATGTGCACAGGGATGTGGG + Intergenic
929626759 2:43416710-43416732 AATTATGAAAAGAGGGCAGTAGG + Intronic
935418368 2:102842243-102842265 AATAATGCAGAGAGGGAGGTAGG - Intronic
936153446 2:110033821-110033843 CTTCATGCTCAGAGGGATGTAGG + Intergenic
936191235 2:110337594-110337616 CTTCATGCTCAGAGGGATGTAGG - Intergenic
936985591 2:118309245-118309267 ATTTATTCAAAGAGGGATGGTGG - Intergenic
937497189 2:122433093-122433115 AATTATTCACTGAGGCAGGTGGG - Intergenic
942267360 2:174242025-174242047 AATTCTGGACAAAGGGATGTTGG + Intronic
942338570 2:174918179-174918201 ATGTATGTACAGTGGGATGTGGG - Intronic
942766811 2:179467123-179467145 AATTATGCACCTGGGGATATGGG - Intronic
943334243 2:186594521-186594543 AATGATGGGCAGAGGGATGGGGG - Intronic
943335543 2:186608975-186608997 AATGATGCAAAGAGGCATGATGG - Intronic
945570177 2:211457610-211457632 AATTTTGCACAGGGAGATGAGGG + Intronic
946833687 2:223750399-223750421 AATTATGGCCAGTGGAATGTGGG - Intergenic
947131814 2:226934824-226934846 AATTATGCACAGAGGGATGTGGG - Intronic
1169002495 20:2178062-2178084 AATGACACACAGAGGGCTGTGGG - Intergenic
1171342207 20:24439171-24439193 TATAAAACACAGAGGGATGTGGG - Intergenic
1173556531 20:43969993-43970015 AATTATCCACAGAGAGCAGTGGG - Intronic
1176846582 21:13881156-13881178 AATTATGGACAGGGGGTTGGTGG - Intergenic
1178095417 21:29209955-29209977 AATTATGAACACAGGGAAGGAGG + Intronic
1178251113 21:31004237-31004259 AAGGATGCTCAGAGGGAGGTTGG - Intergenic
1179107272 21:38413350-38413372 AAGTATGCAGAGAGGGCTCTTGG - Intronic
1184997297 22:48217666-48217688 AAACACGCACAGAGGGATGACGG + Intergenic
1185057383 22:48588046-48588068 CATTATGCACAGATGGAGCTTGG - Intronic
949409537 3:3748899-3748921 AATTATGCACAGAGGGCTATGGG + Intronic
949582573 3:5404588-5404610 AATTATGCCCAGAGGCAACTGGG + Intergenic
950549801 3:13659241-13659263 AATTATTCCAAGAGGGCTGTGGG - Intergenic
952184043 3:30949103-30949125 AATAACACACAAAGGGATGTGGG + Intergenic
952688573 3:36176911-36176933 GTTTAAGCACAGAGGGCTGTAGG + Intergenic
952742846 3:36750966-36750988 AATTTTGCCCAGTTGGATGTTGG - Intergenic
952862754 3:37828299-37828321 AATGCTGCACAGAGGGATGATGG - Intergenic
955797763 3:62655515-62655537 ATTTATGCTCTGAGGGATTTTGG + Intronic
955861999 3:63340788-63340810 AATTATGTACAGAAGGAAGGGGG - Intronic
955881229 3:63548347-63548369 CATTATGCAGATAGGGAAGTTGG - Intronic
958512506 3:95066356-95066378 AATTCTGCAAAGAATGATGTTGG + Intergenic
960301004 3:116002503-116002525 AGCAATGTACAGAGGGATGTAGG - Intronic
961156129 3:124681165-124681187 AAATGGGCACAGAGGGATGTGGG + Intronic
962084957 3:132180921-132180943 AAGTTAGCACAGAGGGCTGTAGG + Intronic
962331693 3:134484472-134484494 AATTATACACAGATTGGTGTGGG + Intronic
965081911 3:164044083-164044105 AATTATTCACAAAGGGTTGTGGG + Intergenic
965200160 3:165648395-165648417 TATTATTAACAGAGAGATGTGGG - Intergenic
971091188 4:23347483-23347505 ATTTAACAACAGAGGGATGTTGG + Intergenic
974280882 4:59791251-59791273 AATTATGCTTAGAGGGAATTGGG + Intergenic
975182201 4:71359087-71359109 AATTAGGAACAGATGGATCTTGG + Intronic
976322236 4:83729024-83729046 AATTATACACAAAGGTATATAGG + Intergenic
977839453 4:101684503-101684525 AATGATGCTCATAGGAATGTAGG + Intronic
979247295 4:118522714-118522736 AATTATGCACATCTGTATGTTGG + Intergenic
985800338 5:2001677-2001699 AGATAGGCACAGAGGGATGAAGG - Intergenic
986785868 5:11113334-11113356 AATTATGCACAACCGGCTGTGGG - Intronic
987108418 5:14663305-14663327 AAATGTGCACAGAGGGAAGAAGG - Intergenic
989406331 5:41065193-41065215 AAATATTGACAGAGGGATGTGGG - Intronic
991413336 5:66366790-66366812 AAATATGAACAGAGGGCTATGGG + Intergenic
997846465 5:137291007-137291029 AACTAAGCACAGAGGAATTTGGG + Intronic
999407964 5:151324003-151324025 AATCCCGCACAGTGGGATGTGGG + Intronic
999917360 5:156277443-156277465 AAAAATGCAAAGAGGGTTGTGGG + Intronic
1000589839 5:163145060-163145082 AATAATGAAAAGAGGTATGTTGG + Intergenic
1000682486 5:164203101-164203123 AATTATGCACTGTGTTATGTAGG - Intergenic
1000815317 5:165914435-165914457 AATTATGCTGAGAAGGCTGTAGG - Intergenic
1001993304 5:176134572-176134594 ATCTAGGCACAGAGGGATGGAGG + Intergenic
1002770077 6:282880-282902 CATGATGCTCAGAGAGATGTGGG + Intergenic
1005529470 6:26688382-26688404 AATTCTGCACACATGCATGTAGG - Intergenic
1005541326 6:26813264-26813286 AATTCTGCACACATGCATGTAGG + Intergenic
1006573233 6:35022736-35022758 AAGTATGCATGGAGGGATGTGGG - Intronic
1007330966 6:41108204-41108226 CATGATGCACAGAGCCATGTGGG + Intergenic
1008831832 6:55774005-55774027 AGTTATGCACAGAGAGTTATGGG - Intronic
1009012129 6:57855328-57855350 AATTATGCACACATGCATGTAGG + Intergenic
1010587529 6:77671827-77671849 AGGTATGCCCAGAGGGATGCTGG + Intergenic
1014786074 6:125621061-125621083 AATTAGGCGCAGAAGGATTTAGG - Intergenic
1017962033 6:159231976-159231998 AAGCAGGCACAGAGGGGTGTTGG - Exonic
1019790749 7:3012009-3012031 AATTATGCAAAGGGGCAGGTAGG - Intronic
1021698630 7:23297064-23297086 ATTTATGAACAAAGGGATGAGGG + Intergenic
1022177218 7:27883072-27883094 AAGTGTGCACTGATGGATGTTGG + Intronic
1022337129 7:29432431-29432453 AATTATGGGGAGAGGGAAGTGGG - Intronic
1024924235 7:54596312-54596334 AAGCTTGCACAGAGGAATGTTGG + Intergenic
1025020169 7:55474460-55474482 AATGAGGCACTGAGGGCTGTCGG + Intronic
1030271750 7:107675880-107675902 AAGTATGCATAGAGAAATGTGGG - Intronic
1031741426 7:125436470-125436492 AAGTATGCACAGAGGAAGCTGGG + Intergenic
1038067558 8:23978895-23978917 ACTTATACACAGAGGGAAGGAGG - Intergenic
1038125987 8:24673297-24673319 AATTATGGGCTGTGGGATGTTGG - Intergenic
1045849797 8:106681324-106681346 AAGTTTGCATAGAAGGATGTAGG + Intronic
1046877096 8:119267391-119267413 AATTATACACAGAGTGCTATAGG + Intergenic
1047037875 8:120959666-120959688 ACTTATGCAGAGAGGGAGTTTGG + Intergenic
1049233401 8:141495862-141495884 ATTTATGAATAGATGGATGTTGG - Intergenic
1049955689 9:690549-690571 AATTGTGCACAGTGGGTGGTGGG + Intronic
1053264489 9:36700736-36700758 AATTGTGCACACAGGGACTTGGG - Intergenic
1054852750 9:69865346-69865368 AAATATGCAAAGAGGAAAGTGGG + Intronic
1055307490 9:74944662-74944684 AATGATGCACAGAGGTGTATTGG - Intergenic
1055755184 9:79550612-79550634 AATCACCCACAGAGGCATGTGGG - Intergenic
1057149638 9:92784875-92784897 AATTGTTGAGAGAGGGATGTTGG + Intergenic
1057284253 9:93737015-93737037 AATTAATGACAGAGGGGTGTTGG + Intergenic
1059426376 9:114223334-114223356 AATTCTGCTCAGAGGGAGGCTGG + Intronic
1059812615 9:117872639-117872661 AAGAATGCACAGACGAATGTAGG + Intergenic
1186068821 X:5795477-5795499 AACTATGCAGAGAGGGAAATAGG - Intergenic
1189357565 X:40322948-40322970 AATTACCCACAGATGGCTGTGGG + Intergenic
1189616294 X:42788148-42788170 AATTGTGTAAAGAGGTATGTTGG - Intergenic
1189737076 X:44082594-44082616 AGTCATGAACAAAGGGATGTTGG - Intergenic
1190579483 X:51877545-51877567 AGGTATGCACAGAGGTTTGTTGG + Intronic
1190969600 X:55335796-55335818 AATTATGCAGACAAGGATGATGG - Intergenic
1191035686 X:56024560-56024582 AATTGTGCACTCAGGGATCTCGG - Intergenic
1191969350 X:66796260-66796282 AATTATGGACAAAGGAATATAGG + Intergenic
1192540065 X:71960902-71960924 ATTTATGCAAAAAGGGATATTGG + Intergenic
1194087907 X:89551942-89551964 AATTAAGCACAGAATGATTTGGG - Intergenic
1194837895 X:98703882-98703904 AATTCTGCAAAGAAAGATGTTGG + Intergenic
1196776755 X:119345094-119345116 AACATTGCATAGAGGGATGTTGG + Intergenic
1200440713 Y:3208859-3208881 AATTAAGCACAGAATGATTTGGG + Intergenic
1201674410 Y:16563107-16563129 AATTCTTCACAGAGAAATGTCGG - Intergenic