ID: 947132222

View in Genome Browser
Species Human (GRCh38)
Location 2:226940472-226940494
Sequence TGCCATTTAAGTCTTGGGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 157}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947132218_947132222 7 Left 947132218 2:226940442-226940464 CCACGTTGTTAAAAATATTAGGT 0: 1
1: 0
2: 0
3: 8
4: 144
Right 947132222 2:226940472-226940494 TGCCATTTAAGTCTTGGGAAGGG 0: 1
1: 0
2: 1
3: 15
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947132222 Original CRISPR TGCCATTTAAGTCTTGGGAA GGG Intronic
901013466 1:6213913-6213935 TGCCCTGTAGGTCTAGGGAATGG + Intronic
902725084 1:18330146-18330168 TGCCACTCAATTCTGGGGAAAGG + Intronic
908134012 1:61109928-61109950 TACAATTTAAGTCATGGAAAGGG + Intronic
912160137 1:106972907-106972929 TGTCTTTAAAGTCATGGGAATGG - Intergenic
912720498 1:112016006-112016028 TGCTATTTATGACGTGGGAAAGG - Intergenic
915586836 1:156848513-156848535 TTTCATTTAAGCCTTAGGAAGGG - Intronic
920303830 1:205006313-205006335 TACTATTAAAGTCTTGAGAACGG - Intronic
920817310 1:209346644-209346666 AGCTTTTTAAGTATTGGGAAGGG - Intergenic
921281948 1:213576001-213576023 ATCCATTTCAGTCTTGGAAAGGG - Intergenic
923735736 1:236605059-236605081 TGCCATTTACCCCTCGGGAATGG - Intergenic
1064039282 10:11944629-11944651 TGTCTTTTAAGTGTTGAGAAAGG - Intronic
1067527888 10:47049325-47049347 TGCCTTTCATGTCTGGGGAATGG + Intergenic
1070646871 10:78207969-78207991 TGCCAGCAATGTCTTGGGAAAGG + Intergenic
1071864719 10:89715145-89715167 AGCCCTTTACGTCTTGGGAAAGG - Exonic
1074604365 10:114945811-114945833 TTCCATTTTAGTATTGTGAAGGG + Intronic
1074906290 10:117866856-117866878 TGCCACCTAACTCTTGGAAAAGG - Intergenic
1075192082 10:120318869-120318891 TGCCATTTAGGTGTTTGGAGAGG + Intergenic
1075813250 10:125244313-125244335 TGCCATTTCAGACTTGGGAATGG - Intergenic
1078124064 11:8541720-8541742 TACAATTTAAGTCTTTTGAAGGG - Intronic
1079680190 11:23286639-23286661 AGCCAGTTTAGTTTTGGGAAGGG - Intergenic
1079791956 11:24749485-24749507 TGCCATTTTAGTCTGTGGACTGG + Intronic
1080362451 11:31531736-31531758 AGCCATTTAAGTTTTTGAAACGG + Intronic
1085554084 11:77403643-77403665 TGCCAGTTAAATTTTGGAAAAGG - Intronic
1085834339 11:79936275-79936297 TGCCATGTGAGTCCTGGGAAAGG - Intergenic
1086053062 11:82616694-82616716 TGCTATTTAAGCCCAGGGAAAGG + Intergenic
1087456334 11:98391582-98391604 TGCCATCTGAGTCTCTGGAAGGG + Intergenic
1088298274 11:108325707-108325729 TGACTTTTAAGCCTTGGGCAAGG + Intronic
1089039104 11:115429040-115429062 TGCTACTGAAGTCATGGGAAAGG + Intronic
1089489046 11:118870300-118870322 TGCCACAAAAGTCTTGTGAAAGG - Intergenic
1090900817 11:131029372-131029394 TAGCAGTTATGTCTTGGGAAAGG + Intergenic
1091156489 11:133379091-133379113 CACCATTTAAGTCTTTGAAAAGG + Intronic
1093296985 12:17403423-17403445 TGACATTTGAGTGATGGGAATGG - Intergenic
1095492152 12:42746064-42746086 AGACATTTTAGTTTTGGGAAGGG - Intergenic
1098778251 12:74651053-74651075 TGCCATCTAAATTCTGGGAAAGG - Intergenic
1098898302 12:76086781-76086803 TGCCATTAAAGTTCAGGGAAGGG + Intergenic
1099384085 12:81993165-81993187 TTCCCTGTAAGTCTTGTGAATGG + Intergenic
1099436873 12:82656540-82656562 TGCTATGTAAGTCCTGTGAAGGG + Intergenic
1100237522 12:92675329-92675351 TGCAATTGAAGTCTTGGCCAGGG - Intergenic
1103594173 12:122013578-122013600 GCCCAGTTAAGTCCTGGGAATGG - Intergenic
1106536832 13:30652406-30652428 AGCTATTTAAATATTGGGAAAGG + Intronic
1107455272 13:40549278-40549300 TGGCATTTCAGTCTTGTTAATGG + Intergenic
1111266526 13:85822466-85822488 TGCCATTTAACTCCTGGAAATGG + Intergenic
1111299801 13:86333438-86333460 TGCCATTTAAGTATTTTGATAGG - Intergenic
1111428858 13:88126021-88126043 TCCCACTTAAGTCTCTGGAATGG + Intergenic
1112352932 13:98651699-98651721 GGCCTTTTAAGTCATAGGAATGG + Intergenic
1112672616 13:101658196-101658218 TGCAATTTAAGTCATGAAAAAGG + Intronic
1112672692 13:101659415-101659437 CACAATTTAAGTCTTGAGAAAGG - Intronic
1113548720 13:111175449-111175471 TGCCATGTGAGTGTGGGGAAGGG + Intronic
1116217680 14:42040546-42040568 AGCCAATTCAGTCTTGAGAAAGG - Intergenic
1118343439 14:64915407-64915429 TGCTATTCAAGTTTAGGGAAAGG + Intronic
1119188657 14:72663592-72663614 TGCCATTTTGGTCTTTGGAACGG + Intronic
1119237993 14:73035602-73035624 AGCCATTTAAGTCTAGAAAAAGG - Intergenic
1121925929 14:97927208-97927230 TGGCAATTAAGTCTTGGAGAAGG + Intronic
1122996348 14:105267284-105267306 TGCCATTTCAGACTTCCGAAAGG - Intronic
1124047115 15:26160643-26160665 TGCAATTTAAGTCATAGCAAAGG + Intergenic
1124204454 15:27704956-27704978 TGCTATTTAAGCATTAGGAATGG - Intergenic
1125406199 15:39354656-39354678 GGCCATTTAATTCTTAGAAAAGG - Intergenic
1126924081 15:53562740-53562762 GTCCATTTATCTCTTGGGAAGGG - Intronic
1128231544 15:66038957-66038979 TGCCAGTGCAGTCTAGGGAATGG + Intronic
1128798973 15:70485106-70485128 AGAGATTCAAGTCTTGGGAAAGG - Intergenic
1129254113 15:74324646-74324668 TTCCATTGGAGCCTTGGGAAGGG - Intronic
1129676743 15:77635721-77635743 TGTCATTTCAGTCTGGGGAGAGG - Intronic
1129959871 15:79674584-79674606 TGGCATTGAAGCCTTAGGAATGG - Intergenic
1130306386 15:82714695-82714717 TGGCAGTTGAGTCTGGGGAAGGG - Intergenic
1131061251 15:89406033-89406055 TGCCTTAAAGGTCTTGGGAATGG + Intergenic
1138020085 16:53470901-53470923 TGCCATTTATGTGATGGCAAAGG + Exonic
1141018080 16:80468840-80468862 TGCTATTTTAGTCTTGGGAGAGG - Intergenic
1147495825 17:40914209-40914231 TGACATATAAGGCTTGGGACTGG + Intergenic
1150666584 17:67144857-67144879 TGCCATTTAATTTTAGGAAAAGG - Intronic
1203171583 17_GL000205v2_random:153398-153420 TGGCTTTGAAGTCTTGGGGAAGG + Intergenic
1153562602 18:6386309-6386331 TGCCATTGATGTCTGGGGAAGGG + Intronic
1155068935 18:22295928-22295950 TGGCATTTAAATCATGGTAAAGG - Intergenic
1155094604 18:22543743-22543765 TGCCAGTTAAGTTGGGGGAAAGG + Intergenic
1155790131 18:29956806-29956828 TGCCATTTATGTTTAGGGAAGGG + Intergenic
1157245245 18:46048060-46048082 TGTCATTAATGTCTTGGGATGGG + Intronic
1158301732 18:56060173-56060195 TACCATTTGAGCCTTGGGTAGGG + Intergenic
1163068509 19:14817771-14817793 TGACAATTAAGTGGTGGGAATGG + Intronic
1164761544 19:30731961-30731983 TGTCATTTCAGTCCTGGGCAAGG + Intergenic
1168506832 19:56942683-56942705 TGCCATTTAAGTCTTGTTTGTGG + Intergenic
927335191 2:21913865-21913887 TGAGATTTAATTCTTGGCAACGG - Intergenic
928438586 2:31272676-31272698 TCCCAATTAATTCTTAGGAAGGG - Intergenic
930575910 2:53148740-53148762 CAACATTTAAGTCTTGGGGAAGG - Intergenic
935309822 2:101772511-101772533 TTTCATTTAGGTCTTTGGAAAGG - Intronic
936738701 2:115477645-115477667 TTCCATATAAGTTTTAGGAAGGG - Intronic
936829230 2:116621978-116622000 TGCCAATTAATTTTTGGCAAGGG + Intergenic
938262555 2:129906052-129906074 TGCTACTTGAGACTTGGGAAAGG - Intergenic
941562607 2:167067145-167067167 TGTAATTGAAGTCTCGGGAAAGG - Intronic
941771331 2:169349110-169349132 TGCCATTTACATCTTAGGGAAGG + Intronic
943562028 2:189475408-189475430 TGCCCTTTAAGCCTTGGAGATGG + Exonic
943932652 2:193874149-193874171 TGCAATTTAATTTTTGTGAATGG + Intergenic
944772149 2:202925389-202925411 TGCCATTTAAATCGAGGGAGTGG - Intronic
947132222 2:226940472-226940494 TGCCATTTAAGTCTTGGGAAGGG + Intronic
947952527 2:234160588-234160610 AGGCATTTAAATCATGGGAATGG - Intergenic
1169657275 20:7939172-7939194 TGCCAGGGAAGTCATGGGAAGGG - Intronic
1169684746 20:8258999-8259021 TTCCATTTATATTTTGGGAAAGG - Intronic
1169685344 20:8265379-8265401 TACCATTTAAGACTTGCCAATGG + Intronic
1170249475 20:14264321-14264343 TGTCATTTAAGATTTTGGAAGGG + Intronic
1170413029 20:16110871-16110893 TACCACATGAGTCTTGGGAAAGG + Intergenic
1176327559 21:5515229-5515251 TGGCTTTGAAGTCTTGGGGAAGG + Intergenic
1176400198 21:6305722-6305744 TGGCTTTGAAGTCTTGGGGAAGG - Intergenic
1176436959 21:6683382-6683404 TGGCTTTGAAGTCTTGGGGAAGG + Intergenic
1176461221 21:7010452-7010474 TGGCTTTGAAGTCTTGGGGAAGG + Intergenic
1176484782 21:7392230-7392252 TGGCTTTGAAGTCTTGGGGAAGG + Intergenic
1177731760 21:25036184-25036206 AGCCATTTAAGACTTTGCAAGGG - Intergenic
1177731866 21:25037552-25037574 TGCCCTTTCAGTCTTAGGGAAGG - Intergenic
1178163170 21:29941762-29941784 TCCCATTTAAGAGTTTGGAAAGG + Intergenic
1178180513 21:30155719-30155741 TGACATTTAAATCTTTGAAAGGG - Intergenic
1178226610 21:30726489-30726511 TTCCTTTTAAGTTTTAGGAATGG + Intergenic
1179308777 21:40178689-40178711 TTTCTTTTAAGTCTTGGGTATGG + Intronic
949456121 3:4240908-4240930 TGTCATTTAAGTCTTTATAAAGG - Intronic
949675528 3:6448633-6448655 TGCAATTTGTGTCATGGGAAAGG + Intergenic
958634982 3:96732269-96732291 TGCCATTTAAGTCTTTGATATGG - Intergenic
958955559 3:100462444-100462466 TGCCTATTAAGTTTTGGGAATGG - Intergenic
959902470 3:111675449-111675471 TGCCATTTTAGTGTTGTTAAGGG + Intronic
960219864 3:115093731-115093753 TGCCCTTTAATTCTTGGGTTCGG - Intronic
961003866 3:123391597-123391619 TGGCATTTAGACCTTGGGAAGGG - Intronic
964072206 3:152648229-152648251 TGCCTTTTATGTCTTGGGTAGGG - Intergenic
965923232 3:173945026-173945048 TTCCATTTAAGTCCAGGTAAAGG - Intronic
969904495 4:10381692-10381714 TGACCTTGAAGTCATGGGAAAGG + Intergenic
970053045 4:11938021-11938043 TGCAATTTAAGAGTTGGCAAAGG - Intergenic
976945721 4:90764869-90764891 TACCATTAAAGTGTTTGGAAGGG - Intronic
978163148 4:105573716-105573738 TGCCATGTAAGTTTTAGGATGGG + Intronic
978187914 4:105879992-105880014 TGCTATTTTTGTCTAGGGAAAGG + Intronic
979572836 4:122250531-122250553 TTCCATTTAAGTCTGAGGAAGGG - Exonic
981528514 4:145731375-145731397 TGTCATTTATTTGTTGGGAATGG - Intronic
983512963 4:168628795-168628817 TGGCATTTATATCTTGGGCAAGG - Intronic
984537982 4:181000821-181000843 TGCCATTTGAGAGATGGGAAAGG - Intergenic
984968506 4:185164745-185164767 TGCCAGGTTAGTCTTAGGAAAGG + Intronic
985708761 5:1416313-1416335 TGCCATTTACTTCTTGAGGATGG - Intronic
986149858 5:5118275-5118297 TGCCATTTAAGTCTTTTCATAGG + Intergenic
987825137 5:23021223-23021245 TTCCCTTCTAGTCTTGGGAAGGG + Intergenic
989019348 5:36983672-36983694 CTCCAGTTAGGTCTTGGGAATGG - Intronic
989345254 5:40422693-40422715 TGGCATTTGAGTTTTGAGAATGG - Intergenic
989710498 5:44390580-44390602 TGCCTCTTAACTCTTGGCAAAGG - Intergenic
990249889 5:53902960-53902982 TGCCATGTCAGTCACGGGAAGGG + Intronic
993547920 5:89235725-89235747 TGGCATTTAAGACATGGGAAAGG - Intergenic
993997427 5:94739473-94739495 TGCCATTGAAGCCTTGTGTAGGG - Intronic
994585534 5:101704506-101704528 TGCTATTTTTGTTTTGGGAAAGG - Intergenic
995852608 5:116561728-116561750 GTCCTTTTAATTCTTGGGAACGG + Intronic
998672999 5:144375046-144375068 TGCTAGTTAATTCTTGGCAAAGG + Intronic
998705975 5:144761158-144761180 TCCCATTTCAGTCTTGGAAGGGG + Intergenic
1001732502 5:173970776-173970798 TGGCATTTATGTCCTGGGAAAGG + Intergenic
1002692308 5:181059070-181059092 TGCCACTTCAGTCCTGGGGAGGG + Intronic
1003400025 6:5783415-5783437 TGCCATTTAACTCTTAGGTGTGG - Intergenic
1007751831 6:44075826-44075848 TGCCATTTACTGCTTGGGAGTGG - Intergenic
1007780231 6:44248484-44248506 TGCATTTTTAGTCTTGGGAAGGG + Intronic
1012078463 6:94725681-94725703 TTCAATTTAAGTTTTGGGAGAGG + Intergenic
1012356000 6:98315321-98315343 TGACACTTCAGACTTGGGAAAGG - Intergenic
1021444373 7:20716950-20716972 GGCCATCTAAGCCTTGGGACTGG - Intronic
1027812672 7:82925211-82925233 TGCCTCTTAAGCATTGGGAAGGG + Intronic
1030282850 7:107794921-107794943 AGGCATTTAAGTGTTGGGACAGG + Intronic
1032280301 7:130494467-130494489 TGCCTTTGAAGTCCTGGGCATGG + Intronic
1034542867 7:151770078-151770100 TTCCATTTAACCCTTGGGGAAGG - Intronic
1041248995 8:55916740-55916762 TGCCATTGCAGTATTGGGCATGG - Intronic
1041984373 8:63903627-63903649 TGCCATTTGTGTCTTGTTAATGG - Intergenic
1043392479 8:79804971-79804993 TGCCATTTAAGTCATGGGTCTGG + Intergenic
1043882667 8:85562884-85562906 TGCATTTTAACTCTTGGCAATGG + Intergenic
1048301768 8:133256570-133256592 TGGTATTTAAGTCTTCTGAATGG + Intronic
1048622414 8:136148365-136148387 AGCTATATCAGTCTTGGGAATGG + Intergenic
1048930101 8:139308116-139308138 TGCCATGAAAGACTTGGAAATGG - Intergenic
1049959212 9:722176-722198 AGGCAGTTTAGTCTTGGGAAGGG - Intronic
1052186515 9:25603119-25603141 TGCCATTTAATTGTAGAGAAGGG - Intergenic
1057953821 9:99391364-99391386 TGCCATTTATGAGATGGGAAAGG + Intergenic
1059256580 9:112936567-112936589 TGCCATTAGAGGCTGGGGAAGGG + Intergenic
1062669214 9:137696785-137696807 TGCCATTTGTGTTTTGGGAGGGG - Intronic
1203434551 Un_GL000195v1:125278-125300 TGGCTTTGAAGTCTTGGGGAAGG - Intergenic
1188247982 X:27857029-27857051 TGTCAATTAAGTCTTGGAGAAGG - Intergenic
1190315499 X:49147982-49148004 TGCCATTTTTGTCTTGGGTGGGG - Intergenic
1191044822 X:56124731-56124753 TGTCTTTTAAGTCTTGGCTATGG + Intergenic
1193447964 X:81628383-81628405 TGTCAATTAAGTTTGGGGAATGG + Intergenic
1193560993 X:83015228-83015250 TGTCATCTGAGTCTTGAGAATGG + Intergenic
1197167497 X:123393980-123394002 TGCCACCTAAGCCTTGTGAAAGG - Intronic
1199187733 X:144937067-144937089 TGCAATTTAAGTGAAGGGAATGG - Intergenic
1201254218 Y:12091230-12091252 TGACATCTAAGCCTTTGGAATGG + Intergenic