ID: 947132358

View in Genome Browser
Species Human (GRCh38)
Location 2:226941778-226941800
Sequence CTGTGTTATGGGTATGTGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 200}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947132358_947132365 25 Left 947132358 2:226941778-226941800 CCATGCACATACCCATAACACAG 0: 1
1: 0
2: 1
3: 9
4: 200
Right 947132365 2:226941826-226941848 ATTTTGGTGAAATTCCTTCCAGG 0: 1
1: 0
2: 2
3: 29
4: 250
947132358_947132364 9 Left 947132358 2:226941778-226941800 CCATGCACATACCCATAACACAG 0: 1
1: 0
2: 1
3: 9
4: 200
Right 947132364 2:226941810-226941832 GGAAAGCACTGTAAATATTTTGG 0: 1
1: 0
2: 4
3: 44
4: 369

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947132358 Original CRISPR CTGTGTTATGGGTATGTGCA TGG (reversed) Intronic
900683213 1:3929683-3929705 GTGTGTTATGTGTATGTGTGTGG - Intergenic
901157084 1:7148390-7148412 GTGTGTTTGGGGTATGTCCATGG - Intronic
901535164 1:9877988-9878010 CTGTGTTCTGTGTTTCTGCAGGG - Exonic
902988882 1:20172206-20172228 GTAGGGTATGGGTATGTGCAGGG - Intronic
905470588 1:38188705-38188727 CTGTGTTAGGGGTTTTGGCAAGG + Intergenic
906300012 1:44674740-44674762 CTGTATTCTGGGAATGGGCAGGG + Exonic
908111713 1:60904606-60904628 CTGTGTCATGGGGCTGGGCAAGG + Intronic
908429143 1:64038639-64038661 GTGTGATCTGGGTATGTTCAGGG - Intronic
911722015 1:101201699-101201721 ATGTGCTATGGTTATGTGTAAGG - Intergenic
912685688 1:111761668-111761690 CTGTTTTATGGTTTTGTGGAAGG + Intronic
917336041 1:173925250-173925272 CTGTGTTAGGAGTAGGTTCAAGG + Intergenic
918056766 1:181028303-181028325 GTGTGTTTTGGATATGTGTATGG - Intergenic
920184053 1:204149748-204149770 CTGTGCTATGAGTACATGCAGGG - Exonic
921550897 1:216534407-216534429 CTGTGTTAGTGCTATGTGCCAGG - Intronic
923226739 1:231944656-231944678 CTGCGTTAAGGGTATGTGGAAGG - Intronic
923566255 1:235078470-235078492 GTGTGTTATGTGTGTGTGTATGG + Intergenic
924687052 1:246304324-246304346 ATGTATTATGGCTATGTCCATGG - Intronic
1062898625 10:1124690-1124712 GTGTATTGTGTGTATGTGCATGG + Intronic
1063104666 10:2982691-2982713 CTGTGTTAAGGGTTTCTGAAAGG - Intergenic
1063139306 10:3242458-3242480 ATGTGTTGTGTGTTTGTGCATGG + Intergenic
1066132003 10:32403512-32403534 CTGTGTGGTGGGTATCTGCCAGG - Intergenic
1066133459 10:32417777-32417799 CTTTGTTTTGTGTATGTACATGG + Intergenic
1066874934 10:40587881-40587903 CTGTGTTTTTGGAATTTGCAAGG + Intergenic
1067466559 10:46503431-46503453 CTGTGCTGTGGGTCTGTGAAGGG - Intergenic
1067620629 10:47881174-47881196 CTGTGCTGTGGGTCTGTGAAGGG + Intergenic
1068472278 10:57480335-57480357 CTGTGTTCTGGGTTTGTGTTAGG + Intergenic
1073120644 10:101120869-101120891 CTGTGCTCTGAGAATGTGCAGGG + Intronic
1074521426 10:114228395-114228417 CTATGTTATTGATATGTGGAGGG + Intronic
1076483779 10:130802568-130802590 CTGGGTGATGCGCATGTGCAGGG - Intergenic
1076988790 11:258181-258203 GTGCGTTAGGGGTATGTCCAGGG - Intergenic
1077006065 11:356822-356844 GTGTGTGGTGTGTATGTGCATGG - Intergenic
1077006099 11:357557-357579 GTGTGTTGTGTGTATGTGTATGG - Intergenic
1078270510 11:9790081-9790103 GTGTGTTATGTAGATGTGCATGG + Intronic
1078958293 11:16229070-16229092 CTATGTGATGGGTAGGTGCTAGG - Intronic
1083877968 11:65534600-65534622 CTGGGCTAGGGGTATGTGCCTGG + Intronic
1086778473 11:90870992-90871014 GTGTGTTAGGGGTATGAGGAGGG + Intergenic
1087258907 11:95988669-95988691 CTGTGTTATGTCCATATGCAAGG - Intronic
1094033257 12:26037987-26038009 CTGTGCTGTGTGTATTTGCACGG + Intronic
1098072763 12:66693718-66693740 CTGTTTTATGGGTCTATTCATGG + Intronic
1098253765 12:68595513-68595535 CTGTGTTTTGGGGAGGGGCAGGG - Intergenic
1102029503 12:109731754-109731776 GTGTGTTCTGGGTGTGTGGAGGG + Intronic
1105014775 12:132779778-132779800 CTGGGGTGTGTGTATGTGCACGG - Intronic
1105688594 13:22813035-22813057 CTGTGTTATGAATTTGTGCTTGG + Intergenic
1105891020 13:24682213-24682235 GTGTGGTGTGTGTATGTGCATGG + Intronic
1105891025 13:24682288-24682310 GTGTGGTGTGTGTATGTGCATGG + Intronic
1107329841 13:39287290-39287312 CAGTGTTATTGGTGTGTTCAGGG - Intergenic
1110702714 13:78567906-78567928 ATGTGTTGTGGGTATGTCTATGG - Intergenic
1111046098 13:82814531-82814553 CAATGTTATGAGTATGTCCAAGG + Intergenic
1112613447 13:100978727-100978749 CAGTGTTGTGGGAATGTACAAGG + Intergenic
1113077325 13:106479997-106480019 CTGTCTTTTGGGAATGTGCGAGG + Intergenic
1114976388 14:28105778-28105800 CTGTGTGTTGGGTATGTAAAAGG + Intergenic
1115549189 14:34489774-34489796 CTGTGTTTTGGTTAGGTGGAGGG + Intergenic
1116425202 14:44782388-44782410 CTGTGTTATAGGTATGTGAAAGG - Intergenic
1120026560 14:79592008-79592030 CTTTGTTATAGGGATGTGGATGG - Intronic
1120424019 14:84324147-84324169 CTTTGTTCTGGGTATGGGTATGG + Intergenic
1124949146 15:34300465-34300487 CTGTGTTATGGCTAGGGGTAGGG - Intronic
1125372744 15:38995815-38995837 CTGTGCTATGGATATCTGAAGGG + Intergenic
1128468079 15:67929398-67929420 CTGTGTGATGGTTAGGTGTATGG - Intergenic
1130153896 15:81333251-81333273 CTGTCTTACAGGTATCTGCACGG - Exonic
1130862921 15:87907495-87907517 CAGTCTTATGGGCAGGTGCATGG - Intronic
1133442689 16:5833986-5834008 CTGTTTTATGTGCATTTGCAGGG - Intergenic
1136045734 16:27613592-27613614 CTGTGTTCTGGGAAGATGCATGG + Intronic
1140246149 16:73251961-73251983 ATGTGTTATGTGTGTGTGCATGG - Intergenic
1141147430 16:81541354-81541376 ATGTGTTTTGGAGATGTGCACGG + Intronic
1141557340 16:84844902-84844924 CTGTAATGTGGGTATGTCCATGG - Intronic
1141936735 16:87244711-87244733 CTTTTTTATGTGTGTGTGCATGG - Intronic
1143537463 17:7549695-7549717 CTGTGTGAGGGGTTTGTGCTGGG + Intronic
1144342620 17:14322725-14322747 CTGTGTTAGGGGTCAGTGAATGG - Intronic
1147262583 17:39217289-39217311 CTGTGTGAGGGGTAGGTGCTGGG - Intronic
1147650738 17:42060461-42060483 CAGTGTGCTGGGTGTGTGCAGGG - Intronic
1149458661 17:56809976-56809998 GTGTGTGAAGGGTCTGTGCAAGG - Intronic
1150252374 17:63713994-63714016 CACTGTGATAGGTATGTGCAGGG - Exonic
1152663991 17:81556770-81556792 CTGTTTTACGTGTATGTGCATGG - Intergenic
1153168655 18:2290607-2290629 ACGTGTTATGGGTCTGTTCAGGG + Intergenic
1153335376 18:3918645-3918667 CTGTGTTATGGGTTGTTCCAGGG + Intronic
1154218147 18:12430724-12430746 CTGTGTAATGTGTATGTGTGTGG + Intronic
1156270318 18:35524470-35524492 CTGAGTTCTGGGTATTTCCATGG - Intergenic
1156562290 18:38138971-38138993 TTGTGATCTGGGTATGTGGATGG - Intergenic
1157111426 18:44824139-44824161 CTGTGTTATGTGTCTGTGTTTGG + Intronic
1164706552 19:30324325-30324347 TTGTGTTTTGGGAATCTGCATGG + Intronic
1166701109 19:44882203-44882225 CTGTGTTGGGGGTCTCTGCAAGG - Exonic
1166868357 19:45854669-45854691 CTGGCTTATGGATATGTGCACGG + Intronic
925130204 2:1489031-1489053 GTGTGTGCTGGGTATGTGCCGGG - Intronic
925130222 2:1489147-1489169 GTGTGTGCTGGGTATGTGCTGGG - Intronic
925130237 2:1489243-1489265 GTGTGTGCTGGGTATGTGCTAGG - Intronic
925816823 2:7761358-7761380 CTGAGTTATGAGTATGTGAGGGG - Intergenic
927061654 2:19428618-19428640 CTGAGATATGAGTATGTGGATGG - Intergenic
928465038 2:31515516-31515538 CTGTGTCATCAGTATTTGCATGG - Intergenic
928963338 2:36952491-36952513 CTGAGTGATGGGTCTGGGCATGG - Intronic
929608648 2:43253279-43253301 CTGTGTGAAGGATGTGTGCAGGG + Intronic
930217894 2:48715710-48715732 CTGTGTTGTGGGTTGGTGGAAGG - Intronic
931910148 2:66890191-66890213 CTTTGTAAAGGGTATGAGCAGGG - Intergenic
932776751 2:74532732-74532754 GTGTGATATGGGGATGGGCAAGG + Exonic
934219824 2:90072582-90072604 CTGTGTCATGGGTATGATCCAGG - Intergenic
934718820 2:96558728-96558750 CGGTCTCATGGGTGTGTGCAGGG - Intergenic
936718478 2:115218966-115218988 CAGTGTGATGGGTATGAGGATGG - Intronic
941455265 2:165707452-165707474 CTCTGTTATGGGTAGGTGTGAGG + Intergenic
941624594 2:167817521-167817543 TTGTGTGATGGGTAAGTGTATGG - Intergenic
944328974 2:198442579-198442601 ATGTGTAATTGCTATGTGCAAGG + Intronic
945385232 2:209190436-209190458 AAGTGTTATGGGAATGTGGAAGG - Intergenic
946676392 2:222164270-222164292 GTGTGTTATTGGCATCTGCATGG + Intergenic
947132358 2:226941778-226941800 CTGTGTTATGGGTATGTGCATGG - Intronic
948082623 2:235219134-235219156 CTGAGTTCAGAGTATGTGCAAGG + Intergenic
1169667978 20:8060271-8060293 CTGTGTAATAGGTAAGTGGAGGG + Intergenic
1169685815 20:8270029-8270051 CTGTGTTTTGGGTTAGTCCAGGG + Intronic
1170602814 20:17854569-17854591 CTGTGTGATGGGGATGAGAAGGG + Intergenic
1173893016 20:46528006-46528028 CTGTGTGCAGTGTATGTGCAGGG + Intergenic
1174488691 20:50877049-50877071 CTCTGTGATGGGTTTTTGCACGG + Exonic
1175289137 20:57862078-57862100 CTGTGTTATGGGGCTGTGGCTGG + Intergenic
1177054605 21:16285591-16285613 CTGTGATATGTGTATGTCAAAGG - Intergenic
1179628561 21:42662486-42662508 GTGTGTGATGTGCATGTGCATGG - Intronic
1179628588 21:42662908-42662930 GTGTGTGATGTGCATGTGCATGG - Intronic
1181015962 22:20068931-20068953 GTGTGGTTTGGGTATCTGCAGGG - Intergenic
1182080259 22:27523863-27523885 CTGTGAAATGGGTATGTAAATGG - Intergenic
1183090139 22:35516741-35516763 CTGTGTTGTGGGAGTGGGCAGGG - Intergenic
950530700 3:13550775-13550797 CTGTGTGATGGGGGTGAGCAGGG + Intronic
951104809 3:18730432-18730454 CTGTGCTATGGGTATGTTTTTGG + Intergenic
951602588 3:24393098-24393120 CTGTGTTATTTGTATTTGTATGG - Intronic
952588535 3:34923172-34923194 ATGTGTCATGGGTATCAGCAAGG - Intergenic
956665741 3:71640590-71640612 TTGTGTTATGAGTATGCACAGGG + Intergenic
958730730 3:97957613-97957635 CTGTTTAATGGGCATGGGCATGG + Intronic
959263320 3:104107435-104107457 CTGTGCTATGTGTTGGTGCAAGG - Intergenic
962374482 3:134848932-134848954 CTGTATTTTGAGTATCTGCAGGG + Intronic
965164870 3:165185036-165185058 CTGTGTTATGAATATGTGCGTGG + Intergenic
965949974 3:174297046-174297068 CCCTGTTCTGGGTATATGCATGG + Intergenic
969549980 4:7859046-7859068 CCGTGTTAGGGGCATGTGCACGG - Intronic
974218705 4:58936069-58936091 CTGTGTTGCGGCTATGTTCAGGG + Intergenic
975294808 4:72721675-72721697 CTTAGTTATGTGTATGTGCCAGG - Intergenic
975720788 4:77246820-77246842 CTGGTATATGGCTATGTGCATGG + Intronic
976153523 4:82117661-82117683 GTATGTTATGGGTATGTTTATGG + Intergenic
977308416 4:95354359-95354381 CTGTGTTTTTGGAATGTGGAGGG - Intronic
979789141 4:124756054-124756076 CTGGTTTACTGGTATGTGCATGG + Intergenic
980267336 4:130534711-130534733 CTGTTTTATGATTATGTCCATGG - Intergenic
981120398 4:141043899-141043921 CAGTGTTATGGTTATCTGGAAGG + Intronic
981788618 4:148509641-148509663 CTGTTTTGTGGTTATGTGTATGG + Intergenic
990327259 5:54690871-54690893 CTCTGTTATGGGTCTTTACATGG + Intergenic
990580657 5:57164418-57164440 CTGTGTTAGAGGCATGTACAGGG - Intergenic
990921149 5:60969208-60969230 CTGTCTTTTGGGTATGTACCTGG + Intronic
991671400 5:69051871-69051893 CTGTGTCATGGGTATGTAGATGG + Intergenic
991671552 5:69053418-69053440 CTAGGTCATGGGTATGTGGATGG - Intergenic
992882664 5:81125997-81126019 CTGTTTTATGCGTTTGTGCTTGG + Intronic
995430356 5:112067830-112067852 CATTGTTTTGGGTATGTGCTAGG - Intergenic
998103337 5:139452086-139452108 GTGTGGTATGTGGATGTGCATGG + Intronic
1000476924 5:161721352-161721374 CTCTGTTTTGGTTATTTGCATGG + Intergenic
1003011884 6:2434251-2434273 CTGTGTCATGGGAATGAGGAAGG + Intergenic
1003159173 6:3620725-3620747 ATGTGGTATGTGTGTGTGCATGG - Intergenic
1003991501 6:11491172-11491194 GTGTGTGATGTGTATGTGTATGG + Intergenic
1005328406 6:24724240-24724262 CTGTGTTATGGGACTGTGCTAGG + Intergenic
1006166773 6:32069978-32070000 CTGTGCTAGGGGCTTGTGCAGGG + Intronic
1006386736 6:33735176-33735198 CTGTGGTGTGGGTGTGTGTAAGG - Intronic
1006789087 6:36686839-36686861 CTGTGTTAGGGGTATATGATGGG + Exonic
1007365959 6:41393179-41393201 CTATATTTTGGGTGTGTGCAGGG - Intergenic
1009325614 6:62345257-62345279 CTTTCTTAGGGGTATGTACAAGG - Intergenic
1011444333 6:87421804-87421826 CTGTGTTGTGTGTCTGTGAATGG - Intronic
1013170423 6:107633503-107633525 CTGTGTTGTAGGTATGTGACTGG + Exonic
1013316116 6:108944787-108944809 GTATGTGATGGTTATGTGCATGG + Intronic
1013360086 6:109385736-109385758 CTTTGTTATGGGCAAGTCCAGGG - Intergenic
1013418251 6:109943805-109943827 CTGTGTTATGGGAATAAGCTTGG - Intergenic
1015180448 6:130356273-130356295 GAGTGTTCTGGGTATGTGTAGGG - Intronic
1015634109 6:135259246-135259268 CTGTGTTGTGTTTAGGTGCATGG - Intergenic
1016245926 6:141980768-141980790 CTGTGGTAGGAGTATGTGTAAGG - Intergenic
1017717811 6:157224467-157224489 CTGTGTCAAGGGAATGTGCTGGG - Intergenic
1018253638 6:161896552-161896574 GTGGGTTATGGGTTTGGGCAGGG - Intronic
1018410119 6:163536666-163536688 CTATGTTATTGCTATGTGCTGGG - Intronic
1020153975 7:5706539-5706561 CTGTGTTGTTAGTATGTGCCAGG + Intronic
1020982926 7:15094680-15094702 ATGAGTTAAGGGTATATGCAAGG + Intergenic
1021176015 7:17450120-17450142 CTTTTCTATGGGTATGTACAGGG + Intergenic
1024524230 7:50335138-50335160 ATGTGTGATGTGTATGTGTATGG + Intronic
1025756973 7:64352966-64352988 CTTTCCTATGGGTATGTTCAGGG + Exonic
1026441934 7:70452560-70452582 GTGTGTTATGGTTTTTTGCAGGG - Intronic
1029891033 7:103930756-103930778 ATGTGTTATGGGGCTGGGCACGG - Intronic
1031737798 7:125388665-125388687 CTGTGTGAAGGGCATGTGAATGG + Intergenic
1032007559 7:128315226-128315248 CTGTGTTATGGGAAGGGGAATGG - Intronic
1033413400 7:141140792-141140814 CTGAGTTATGGGTATTTGAGAGG + Intronic
1034830422 7:154303662-154303684 GTGTGGTATGGGTGTGTGCTTGG - Intronic
1036753422 8:11457017-11457039 CTGGGTTAGGGGTATGGGCGGGG + Intronic
1037748824 8:21666897-21666919 ATGTGTGATGAGTATTTGCAGGG - Intergenic
1038880824 8:31609223-31609245 CTGTGTCATGGCTAAGAGCATGG + Intergenic
1039268322 8:35853364-35853386 CTGTGGTCTGAGTATGTGCTTGG + Intergenic
1041971516 8:63748220-63748242 CTGTTTGATGTGTATGTACAAGG - Intergenic
1044253042 8:90026401-90026423 GTGTGTTATTGGTATATTCAGGG + Intronic
1046453062 8:114419260-114419282 GAGTGTTATGGGTCTGTTCAGGG - Intergenic
1049035227 8:140070418-140070440 ATGTATTATGGATATATGCATGG - Intronic
1050216996 9:3337669-3337691 CTGTGCTACGGTTTTGTGCATGG + Intronic
1051405018 9:16727630-16727652 CTGTGTTACTGGAATGTGCAGGG - Intronic
1052537441 9:29765087-29765109 CTGTTTTATTGGTCTGTTCAGGG - Intergenic
1052887297 9:33662298-33662320 CTCTGTGTTGGGTTTGTGCATGG + Intergenic
1057065120 9:92042356-92042378 TTGTGTTATGATGATGTGCATGG - Intronic
1057896270 9:98911510-98911532 CTGTGTAATATGTATGTGTAGGG + Intergenic
1058570965 9:106343261-106343283 CAGTGACATGGGTATGTTCAAGG + Intergenic
1059486155 9:114628468-114628490 CTGTGTTTTGGGAATGTGAGAGG + Intronic
1060770535 9:126328458-126328480 TTGTGCCATGGTTATGTGCAGGG + Intronic
1186500331 X:10045615-10045637 CTCAGTTTTGGGGATGTGCATGG + Intronic
1186852260 X:13592269-13592291 CTTTGTTATGGATATGTACTTGG - Intronic
1190109069 X:47578307-47578329 CTGTGTGTTGAGTATGTGCCCGG - Intronic
1191155027 X:57265283-57265305 CTTTCTTAGGGGTATGTACAGGG - Intergenic
1194143225 X:90231162-90231184 CTCTGTTATGGGAATGAGAAAGG + Intergenic
1194358629 X:92919181-92919203 CTCTGTTCTGGGCATGGGCAAGG + Intergenic
1194981963 X:100450254-100450276 CTGTGTTCTGGGTATTTCCCTGG - Intergenic
1195729417 X:107950982-107951004 CTGAGTTATGAGTATGTACGGGG - Intergenic
1198705374 X:139443202-139443224 CTTTGCTAGGGGTATGTACAGGG - Intergenic
1200666806 Y:6034871-6034893 CTCTGTTCTGGGCATGGGCAAGG + Intergenic
1200987285 Y:9316160-9316182 CTCAGTAATGCGTATGTGCAAGG - Intergenic
1201398703 Y:13578579-13578601 CTAAGCTATGGGTATGTGAAAGG + Intergenic
1202118299 Y:21496488-21496510 CTCAGTAATGCGTATGTGCAAGG + Intergenic
1202120751 Y:21520028-21520050 CTCAGTAATGCGTATGTGCAAGG + Intronic
1202123202 Y:21543569-21543591 CTCAGTAATGCGTATGTGCAAGG + Intronic
1202155804 Y:21885812-21885834 CTCAGTAATGCGTATGTGCAAGG - Intronic
1202158252 Y:21909353-21909375 CTCAGTAATGCGTATGTGCAAGG - Intronic
1202184705 Y:22174278-22174300 CTCAGTAATGCGTATGTGCAAGG - Intronic
1202206655 Y:22412123-22412145 CTCAGTAATGCGTATGTGCAAGG + Intronic