ID: 947137168

View in Genome Browser
Species Human (GRCh38)
Location 2:226987053-226987075
Sequence CATTCTCAGCACAGTAACAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 9675
Summary {0: 1, 1: 100, 2: 3291, 3: 3241, 4: 3042}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947137165_947137168 11 Left 947137165 2:226987019-226987041 CCTTTGCAGGGACATGGATGAAG 0: 5722
1: 13953
2: 17651
3: 7003
4: 4429
Right 947137168 2:226987053-226987075 CATTCTCAGCACAGTAACACAGG 0: 1
1: 100
2: 3291
3: 3241
4: 3042

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947137168 Original CRISPR CATTCTCAGCACAGTAACAC AGG Intronic
Too many off-targets to display for this crispr