ID: 947145390

View in Genome Browser
Species Human (GRCh38)
Location 2:227059482-227059504
Sequence GGTCCCAGGTGACCAAATGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 131}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947145378_947145390 10 Left 947145378 2:227059449-227059471 CCTGGCACTCCTGAAAGACCCCT 0: 1
1: 0
2: 1
3: 18
4: 175
Right 947145390 2:227059482-227059504 GGTCCCAGGTGACCAAATGCAGG 0: 1
1: 0
2: 1
3: 6
4: 131
947145377_947145390 11 Left 947145377 2:227059448-227059470 CCCTGGCACTCCTGAAAGACCCC 0: 1
1: 0
2: 1
3: 18
4: 185
Right 947145390 2:227059482-227059504 GGTCCCAGGTGACCAAATGCAGG 0: 1
1: 0
2: 1
3: 6
4: 131
947145376_947145390 19 Left 947145376 2:227059440-227059462 CCTTTTATCCCTGGCACTCCTGA 0: 1
1: 0
2: 0
3: 20
4: 226
Right 947145390 2:227059482-227059504 GGTCCCAGGTGACCAAATGCAGG 0: 1
1: 0
2: 1
3: 6
4: 131
947145374_947145390 28 Left 947145374 2:227059431-227059453 CCTCTGGGTCCTTTTATCCCTGG 0: 1
1: 0
2: 2
3: 20
4: 220
Right 947145390 2:227059482-227059504 GGTCCCAGGTGACCAAATGCAGG 0: 1
1: 0
2: 1
3: 6
4: 131
947145387_947145390 -10 Left 947145387 2:227059469-227059491 CCTCTTTCCCGGGGGTCCCAGGT 0: 1
1: 0
2: 1
3: 11
4: 166
Right 947145390 2:227059482-227059504 GGTCCCAGGTGACCAAATGCAGG 0: 1
1: 0
2: 1
3: 6
4: 131
947145384_947145390 -8 Left 947145384 2:227059467-227059489 CCCCTCTTTCCCGGGGGTCCCAG 0: 1
1: 0
2: 0
3: 24
4: 217
Right 947145390 2:227059482-227059504 GGTCCCAGGTGACCAAATGCAGG 0: 1
1: 0
2: 1
3: 6
4: 131
947145379_947145390 1 Left 947145379 2:227059458-227059480 CCTGAAAGACCCCTCTTTCCCGG 0: 1
1: 0
2: 0
3: 7
4: 108
Right 947145390 2:227059482-227059504 GGTCCCAGGTGACCAAATGCAGG 0: 1
1: 0
2: 1
3: 6
4: 131
947145385_947145390 -9 Left 947145385 2:227059468-227059490 CCCTCTTTCCCGGGGGTCCCAGG 0: 1
1: 0
2: 1
3: 29
4: 230
Right 947145390 2:227059482-227059504 GGTCCCAGGTGACCAAATGCAGG 0: 1
1: 0
2: 1
3: 6
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947145390 Original CRISPR GGTCCCAGGTGACCAAATGC AGG Exonic
901961280 1:12828445-12828467 GGGCCCAGGTGTCCAACTGAAGG - Intronic
901967873 1:12883050-12883072 GGGCCCAGGTGTCCAACTGAAGG - Intronic
901983271 1:13053315-13053337 GGGCCCAGGTGTCCAACTGAAGG - Intronic
901998818 1:13175603-13175625 GGGCCCAGGTGTCCAACTGAAGG + Intergenic
902017303 1:13318730-13318752 GGGCCCAGGTGTCCAACTGAAGG + Intronic
914979147 1:152397509-152397531 AGTCCCTGGTGCCAAAATGCCGG - Intergenic
918226484 1:182488204-182488226 GCTCCCAGGTGAACATATGCAGG + Intronic
918289934 1:183097695-183097717 GGTCCCACATGAACAAAGGCTGG + Intronic
922971293 1:229742274-229742296 GGTCCTAAGTGAACTAATGCAGG - Intergenic
924657175 1:245983458-245983480 GGTCCCAGGGGGCCACGTGCTGG - Intronic
1065937271 10:30531849-30531871 AGGACCAGGTGACCAAAAGCTGG + Intergenic
1075818800 10:125287571-125287593 GGACCCAGGTGACCAGATTAGGG + Intergenic
1076791260 10:132777939-132777961 GCTCAGAGGTGACCCAATGCTGG - Intronic
1077234636 11:1474069-1474091 AGTCCCAGGTGGCCACATCCTGG + Intronic
1077976178 11:7251479-7251501 GGTGTCAGATGCCCAAATGCAGG - Intronic
1083393485 11:62372451-62372473 TGTCCCAGCTGACCATATTCAGG - Intronic
1083752729 11:64769949-64769971 GGGCCCAGGTGAGTAACTGCTGG - Exonic
1084400484 11:68940197-68940219 GTTCCCATGTGGCCAGATGCTGG + Exonic
1085033319 11:73285790-73285812 GGTCCCAGGAGACCTAGTGGTGG - Intronic
1089785095 11:120902046-120902068 GTTCCCAGGTGACCATCTGTGGG + Intronic
1090670436 11:128941764-128941786 GGTCCCAGCAGACCAAGTCCTGG - Intronic
1090852430 11:130582326-130582348 GGACCCAGGTGTCCTACTGCTGG + Intergenic
1093963291 12:25299069-25299091 GTTCCCCACTGACCAAATGCAGG - Intergenic
1097379185 12:58874879-58874901 GGTCCCAGATGACCAGAACCAGG + Intronic
1097590022 12:61563250-61563272 GGTAACAGGTGACCAAGTTCTGG + Intergenic
1101834871 12:108288186-108288208 GGCCCAAGGTTACCAAATCCTGG - Exonic
1106906636 13:34416228-34416250 GCTCCCAGGTAACCAGAAGCAGG + Intergenic
1107644470 13:42479541-42479563 CTTCCCAGTTGCCCAAATGCTGG - Intergenic
1108684802 13:52809485-52809507 GGCCCCAGGTGACCACAAGGTGG - Intergenic
1112434032 13:99377881-99377903 GGCCCCGTGTGACCACATGCAGG - Intronic
1113038811 13:106081906-106081928 GCTCCCAGGTGATCCAGTGCTGG - Intergenic
1114567525 14:23643611-23643633 GGTCCCTGGAGACCAAGCGCAGG - Intronic
1115478029 14:33835080-33835102 CGTGTCAGGAGACCAAATGCAGG + Intergenic
1116170385 14:41393507-41393529 GGTCCCTGGTGCCCAAAGACTGG - Intergenic
1118209612 14:63753152-63753174 GGTGCCAGCTGACCAAGCGCAGG + Intergenic
1118968186 14:70607769-70607791 GTTACCAGGTGACCAAACCCAGG - Intergenic
1124625967 15:31307660-31307682 GGTACCAGGTGCCAAAATGCAGG - Intergenic
1128152334 15:65371132-65371154 GGTCCCAGGTGTCTCAATCCTGG - Intronic
1136146113 16:28317610-28317632 GGGCACAGGTGAACAAGTGCAGG + Exonic
1141681452 16:85546721-85546743 GGGGCCAGGTGACCAAGTTCTGG - Intergenic
1142114843 16:88351241-88351263 GGTCCCGGGTGCCCAGCTGCGGG + Intergenic
1145907537 17:28524582-28524604 GGGCCCTGGTGACGCAATGCGGG - Exonic
1147728848 17:42584301-42584323 GGGCCTTGGTGACCAAGTGCAGG + Intronic
1148123939 17:45227382-45227404 GGTCTTAGGTGAGCAGATGCTGG + Intronic
1149815492 17:59719251-59719273 GGTCACAGGTCACCACAGGCTGG - Intronic
1152246240 17:79186096-79186118 GCACACAGGTGACCAGATGCAGG - Intronic
1156482336 18:37444222-37444244 GGTGCCTGGATACCAAATGCAGG - Intronic
1158124901 18:54090404-54090426 TGTAGCAGGTGTCCAAATGCTGG - Intergenic
1158410425 18:57200346-57200368 GGTCCCAGTAGACCAAAGGAAGG - Intergenic
1160833011 19:1112086-1112108 GACCCCAGGTGACCAACTGATGG - Intronic
1162502588 19:11062480-11062502 GGTCTCAGCTGAACAAATGCTGG - Intronic
1163119790 19:15210539-15210561 GGCCCAAGGGGCCCAAATGCAGG - Intergenic
1163370361 19:16897814-16897836 GGTGGCGGGTGACCAAGTGCAGG + Intronic
1164527452 19:29022515-29022537 GGGCCCAGGTGAGCACATGGTGG + Intergenic
927470543 2:23372603-23372625 GGCCCAAGGTGACAAAATCCAGG + Intergenic
929337089 2:40762211-40762233 CTTCCCAGGTGGCCAAATGGTGG - Intergenic
930015946 2:46970621-46970643 TGGCCCAGGAGACCAACTGCAGG - Intronic
931011179 2:57916024-57916046 GGTCCCTGGTGCCAAAAGGCTGG + Intronic
934108575 2:88719860-88719882 TGACCCAGGTGCCCATATGCTGG + Intronic
935079730 2:99780806-99780828 GGTCGCAGGTGACTAGATCCAGG - Intronic
939820762 2:146954564-146954586 GGTGACAGGTGAACAAATTCAGG + Intergenic
940800579 2:158128495-158128517 GGTACAAGGAGACCAATTGCAGG + Intronic
942077166 2:172366623-172366645 AGTCCCAGATGTCCCAATGCTGG + Intergenic
943448339 2:188018023-188018045 GATCCCAGCTGACCCCATGCTGG + Intergenic
946432180 2:219631754-219631776 GGTCCCAGGTGACCATGGGGAGG + Intronic
946637640 2:221747392-221747414 TGTGACAGGTGTCCAAATGCTGG - Intergenic
947145390 2:227059482-227059504 GGTCCCAGGTGACCAAATGCAGG + Exonic
947915948 2:233831568-233831590 CGTCCCAGGTGGCCACACGCTGG + Intronic
949046551 2:241874935-241874957 GGTCTCAGGGGCCGAAATGCAGG + Intergenic
949046868 2:241876469-241876491 GGTCTCAGGGGCCCAACTGCAGG + Intergenic
949046901 2:241876573-241876595 GGTCTCAGGGGCCCAACTGCAGG + Intergenic
949046917 2:241876627-241876649 GGTCCCAGGGGCCGAAATGCAGG + Intergenic
1170160803 20:13308295-13308317 GGTACCATGGGACCAAATGAGGG + Intergenic
1173390919 20:42631985-42632007 GGCCCCAGGTGAACAAAAACAGG - Intronic
1175393005 20:58638954-58638976 TGTCCCAGAGAACCAAATGCAGG + Intergenic
1177080825 21:16636562-16636584 TTTCCCAGGTGACAATATGCTGG - Intergenic
1181433439 22:22896382-22896404 GGTCCCCGGAGACCAGATGAGGG + Intergenic
1181995253 22:26874071-26874093 TATGCCACGTGACCAAATGCTGG - Intergenic
1182052264 22:27322509-27322531 GGTCCCAGATGAACAATTTCTGG - Intergenic
1183247745 22:36706787-36706809 CTTCCCAAGTAACCAAATGCAGG - Intergenic
1183716320 22:39535504-39535526 GGTCGCAGGTGCCCAAATGCGGG - Intergenic
1184075355 22:42173791-42173813 GGTCCCAGGTCTCCACATGAAGG + Intronic
1184944963 22:47796343-47796365 GGTCCCACGTGGGCAACTGCAGG + Intergenic
1185024986 22:48403703-48403725 GGTCCCAGGTAAAGAAAGGCAGG + Intergenic
951752808 3:26055926-26055948 TATCCCAGGTGACCACATGCAGG - Intergenic
952077043 3:29709389-29709411 GGTCCCAGGTGAAAAGATGAAGG - Intronic
952591837 3:34964566-34964588 GTTCCAAGGTGTCCAAATGGTGG + Intergenic
953403895 3:42650870-42650892 GGTCCTAGGTGACCAGAGGCTGG - Intergenic
955403825 3:58612594-58612616 GGACCCAGGTAACCAGATGGAGG + Intronic
956764436 3:72472497-72472519 GGTCCCAGGTGCCAAAAAGTTGG + Intergenic
956834994 3:73089460-73089482 GCTCCCAGGTAAAGAAATGCAGG + Intergenic
957752514 3:84440310-84440332 GGTCCCTGGTGCCAAAATGTTGG - Intergenic
965225705 3:165986986-165987008 GGACTCAGGTGGCCTAATGCAGG - Intergenic
969234942 4:5859145-5859167 TGTACCAGGTGAACAAAAGCAGG - Intronic
970234928 4:13949026-13949048 GTTCCCAGGTTTTCAAATGCTGG + Intergenic
973198169 4:47469283-47469305 GTTTCCAGGTGATGAAATGCAGG - Intergenic
973642118 4:52913689-52913711 GGTCCCTGGTGACAAAAAGGTGG + Intronic
978447016 4:108789449-108789471 TGTCCCAGCTGACCATATTCAGG + Intergenic
978771705 4:112463745-112463767 GATCCCAAGTGAACTAATGCAGG + Intergenic
980428365 4:132657056-132657078 TTTCCCAGATGAGCAAATGCTGG - Intergenic
981459492 4:144996474-144996496 GGTCCCAACTGACCAGCTGCAGG + Intronic
986162879 5:5247260-5247282 GCTCAAAGGTGACCAAAGGCAGG - Intronic
987585269 5:19846630-19846652 GGTTCCACATGACCAACTGCTGG + Intronic
988543363 5:32133413-32133435 GTTCCCAGCTGACCAAAAGAAGG - Intronic
990442606 5:55861580-55861602 GGTCCCTGGTGCCAAAATGTAGG + Intronic
994082144 5:95718867-95718889 GGTCCCAGGAGAGCACAAGCAGG + Intronic
994643539 5:102440622-102440644 GGTCCCTGGTGTCAAAATGTTGG + Intronic
994916273 5:105983198-105983220 GGTCTCAGGTAACCCAAAGCTGG - Intergenic
1002308440 5:178298019-178298041 GCTTCCAGGTGACCATATGGTGG + Intronic
1002472999 5:179448417-179448439 GGTGCCAGGTGACCTCACGCAGG - Intergenic
1002481225 5:179502237-179502259 GGTGCCAGGTGACCTCACGCAGG + Intergenic
1002924924 6:1599847-1599869 TCCCCCAGGTGACCAATTGCTGG - Intergenic
1004601241 6:17152007-17152029 AGTCCAAGGTGAACAATTGCTGG + Intergenic
1007515310 6:42406200-42406222 GGCCCCAGGTGACTAACTCCAGG + Intronic
1012691479 6:102318753-102318775 GGTCCCAGAAGAACAAAAGCTGG - Intergenic
1013404125 6:109827666-109827688 GGTACCAGGTTAGCAAGTGCTGG - Intergenic
1018096662 6:160393195-160393217 GGACCCAGGTGACCATCAGCTGG - Intronic
1022648188 7:32251197-32251219 GGTGGCAGGTGAGCAAATGTGGG - Intronic
1025111013 7:56216212-56216234 TGGCTCAGGTGACCTAATGCAGG + Intergenic
1026306888 7:69150225-69150247 TGGCTCAGGTGACCTAATGCAGG - Intergenic
1026353563 7:69538263-69538285 GCTCCCAGGTGATGTAATGCTGG - Intergenic
1031683877 7:124709000-124709022 GTGCCCAGGTGCCCAAATGGTGG + Intergenic
1031754371 7:125619082-125619104 GATCCCAGGAGACCAAAAGATGG - Intergenic
1033062646 7:138122998-138123020 GGTCCCAGCTGACCACATTGAGG - Intergenic
1033566654 7:142585406-142585428 GGACTCAGGTGACCCAAAGCTGG - Intergenic
1035006633 7:155667620-155667642 GGTCCATTGTGACTAAATGCGGG + Intronic
1036604844 8:10295692-10295714 GGTGCCAAGTGACCACAGGCTGG - Intronic
1041451792 8:58013552-58013574 AGTCCCAGGTGACCCAAACCAGG + Intronic
1048392015 8:133975768-133975790 GGTCCAAAGTGGCCAAATGGAGG - Intergenic
1048558361 8:135505370-135505392 GGTCCCAAGGGACCACAAGCAGG - Intronic
1052863748 9:33452801-33452823 TGTCCCAGGTGACCCAAGGAGGG - Intergenic
1058194536 9:101956540-101956562 GATCTAAGGTGACCAAAGGCAGG - Intergenic
1062208579 9:135350751-135350773 GGTCTCAGGAGCCCAAATGGAGG + Intergenic
1062648611 9:137564066-137564088 AGTCCCAGCTGACCACAGGCAGG + Intronic
1185494016 X:540627-540649 GGTCACAGGTCAACGAATGCAGG - Intergenic
1186190852 X:7066367-7066389 GGTTCCTGGTGCCAAAATGCTGG - Intronic
1190417380 X:50193330-50193352 GGTCCCATGATCCCAAATGCAGG - Exonic
1194543805 X:95206558-95206580 GGTCCCAGGTTGGCATATGCTGG - Intergenic
1194811305 X:98390330-98390352 TGTCCCTGGTGGCCAAATGGAGG + Intergenic