ID: 947154254

View in Genome Browser
Species Human (GRCh38)
Location 2:227145524-227145546
Sequence TTAAGCGTTAAATAAGATGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 173}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947154254_947154260 26 Left 947154254 2:227145524-227145546 CCATCATCTTATTTAACGCTTAA 0: 1
1: 0
2: 1
3: 15
4: 173
Right 947154260 2:227145573-227145595 ACACCATTCCAAAGGATGGTAGG 0: 1
1: 0
2: 0
3: 4
4: 122
947154254_947154257 1 Left 947154254 2:227145524-227145546 CCATCATCTTATTTAACGCTTAA 0: 1
1: 0
2: 1
3: 15
4: 173
Right 947154257 2:227145548-227145570 ACAGCTGTGGTTAGAACTTCGGG 0: 1
1: 0
2: 1
3: 18
4: 167
947154254_947154258 18 Left 947154254 2:227145524-227145546 CCATCATCTTATTTAACGCTTAA 0: 1
1: 0
2: 1
3: 15
4: 173
Right 947154258 2:227145565-227145587 TTCGGGTCACACCATTCCAAAGG 0: 1
1: 0
2: 0
3: 1
4: 68
947154254_947154256 0 Left 947154254 2:227145524-227145546 CCATCATCTTATTTAACGCTTAA 0: 1
1: 0
2: 1
3: 15
4: 173
Right 947154256 2:227145547-227145569 AACAGCTGTGGTTAGAACTTCGG 0: 1
1: 0
2: 2
3: 9
4: 197
947154254_947154259 22 Left 947154254 2:227145524-227145546 CCATCATCTTATTTAACGCTTAA 0: 1
1: 0
2: 1
3: 15
4: 173
Right 947154259 2:227145569-227145591 GGTCACACCATTCCAAAGGATGG 0: 1
1: 0
2: 3
3: 10
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947154254 Original CRISPR TTAAGCGTTAAATAAGATGA TGG (reversed) Intronic
906186731 1:43867849-43867871 ATAAGGGTTGAATAGGATGAAGG + Intronic
907016393 1:51018375-51018397 TTTAGGGTAAAATAAGAGGATGG - Intergenic
908365789 1:63422537-63422559 TTATAGGTCAAATAAGATGAGGG + Intronic
908622588 1:66001036-66001058 TTAAGAGTTAAATGAGTAGAGGG + Intronic
909461901 1:75926342-75926364 TTAAATATTAAATAAGATGATGG + Intronic
910990512 1:93051291-93051313 TTAAGCCTTAAGTAAAATGCAGG + Intergenic
911122176 1:94307636-94307658 GTAAGGGTAAAATAAGATAAAGG + Intergenic
911672769 1:100625837-100625859 TTAAGAGTTAAATGAGATAATGG + Intergenic
911893112 1:103397726-103397748 CAAAGCGTTAAACTAGATGAAGG - Intergenic
913392816 1:118333542-118333564 TTAAACTCTAAATAACATGAAGG - Intergenic
916158154 1:161878742-161878764 TGAGACGTTAGATAAGATGAAGG + Intronic
919653535 1:200174941-200174963 TTAACACTTACATAAGATGAGGG - Exonic
920489224 1:206400229-206400251 TTAAGCAATAGAGAAGATGATGG + Intronic
920654803 1:207867531-207867553 ATAAGCGTTATATAACATGGTGG + Intergenic
921397893 1:214688372-214688394 CTAAGGATTAAATAAGACGATGG - Intergenic
924045047 1:240020400-240020422 TTAATCGTTAAACAAGAAGGAGG - Intronic
924414168 1:243841338-243841360 TTGAGGGTTAAATGAGATGATGG - Intronic
924872792 1:248067485-248067507 TTAATAGCTAAATAATATGAGGG + Intronic
1063722290 10:8596451-8596473 TTACACGTTTAATAAAATGAAGG + Intergenic
1066440352 10:35432890-35432912 TTAAGGATCAAATAAGATGCTGG - Intronic
1067137055 10:43618905-43618927 TTACCTGTTAAATATGATGATGG - Intergenic
1070044050 10:72812992-72813014 CTAAACATTAAATAACATGAGGG + Intronic
1071217654 10:83426696-83426718 TTAGTCCTTAAATAAAATGAAGG - Intergenic
1073090251 10:100931507-100931529 TTAAGCGTTAAATATGAATGGGG - Intronic
1074777640 10:116778020-116778042 TTAAGAGTTAAATAACAGGCTGG - Intergenic
1078938397 11:15973301-15973323 TTAGGGGTTAAACAATATGATGG + Intronic
1079995611 11:27292349-27292371 TTAAGCCTTAAATCAAATGCAGG - Intergenic
1085916250 11:80891640-80891662 TTAAGGATTAAATGAGATCATGG - Intergenic
1086803448 11:91207585-91207607 TTATCAATTAAATAAGATGAAGG - Intergenic
1087892211 11:103548219-103548241 TTTAGGTTTAAATAAGATTATGG - Intergenic
1088547803 11:110978830-110978852 ATAAGTGCAAAATAAGATGATGG + Intergenic
1093947268 12:25123948-25123970 TTAAGGGTCAAATAAGATAATGG + Intronic
1095335471 12:41019519-41019541 TTAAACATTAAATAGGATTATGG + Intronic
1095798278 12:46244866-46244888 TTAAGGGAGAAATAAAATGAAGG - Intronic
1098538287 12:71620992-71621014 TCAAATGTTAAATAAAATGAAGG - Intronic
1098803972 12:74998348-74998370 TTAAGCTTCAAATAATTTGAGGG - Intergenic
1100628789 12:96365304-96365326 TTAAGAGTCAAATAAAATGATGG - Intronic
1100686393 12:96991043-96991065 TTTATCAATAAATAAGATGATGG + Intergenic
1100903146 12:99266394-99266416 ATAAGCCTTAAATAAGATAATGG - Intronic
1101256967 12:102988119-102988141 ATAAAGGTTAAATAAGATAATGG - Intergenic
1101318906 12:103655527-103655549 TGAAGCATTGAATAACATGAAGG + Exonic
1105741779 13:23332714-23332736 TTAAGCATTAAAGAACAAGAAGG - Exonic
1109872837 13:68358072-68358094 TCAAGCGTTTAATCAGATAATGG - Intergenic
1110797074 13:79652026-79652048 TTAAGGGTTATAAAAGAAGAAGG - Intergenic
1111444867 13:88334417-88334439 TTCAGTTGTAAATAAGATGAGGG + Intergenic
1114995575 14:28347742-28347764 TTAGGTGTTAGATAAGATTATGG - Intergenic
1116185592 14:41597047-41597069 TTATACTTTTAATAAGATGAGGG - Intergenic
1119961359 14:78860379-78860401 TTAAGGTTTATATAAGATGGAGG - Intronic
1120278714 14:82411398-82411420 GTAAGAATTAAATAAGATGCAGG - Intergenic
1123509334 15:20980483-20980505 TTAAACCTTAATTAAGCTGAGGG - Intergenic
1123566558 15:21554227-21554249 TTAAACCTTAATTAAGCTGAGGG - Intergenic
1123602819 15:21991516-21991538 TTAAACCTTAATTAAGCTGAGGG - Intergenic
1126252131 15:46579770-46579792 GTAAGAATTAAATAAGATGTTGG - Intergenic
1126591651 15:50346232-50346254 TTAAGAGTTAAAGAGGAAGAAGG + Intronic
1129958943 15:79665680-79665702 TAACGCATTAAATAAGCTGAAGG + Intergenic
1130207482 15:81890351-81890373 TAAAGCGTTGATTAAGTTGATGG - Intergenic
1131970459 15:97887416-97887438 TTACGTGTTAAATTCGATGATGG - Intergenic
1202974920 15_KI270727v1_random:281318-281340 TTAAACCTTAATTAAGCTGAGGG - Intergenic
1133489972 16:6258111-6258133 TAAAACGTTACAAAAGATGATGG - Intronic
1135082047 16:19444789-19444811 TTAGGCTTTAAATAACATGAGGG - Intronic
1135539891 16:23321638-23321660 TCAAGGATTAAATGAGATGATGG + Intronic
1138149236 16:54640566-54640588 TTAAACTTTTAATAAAATGAAGG + Intergenic
1138155233 16:54696821-54696843 TTAATAGTTTAATAACATGAAGG + Intergenic
1139109865 16:63876836-63876858 TTAAGCCGAAGATAAGATGATGG - Intergenic
1146079858 17:29769624-29769646 TTAAACATCAAATAAGATGATGG - Intronic
1146805745 17:35863870-35863892 GTAAGAGTTAAATGAGATTATGG + Intronic
1147643336 17:42018391-42018413 CTAAGAGTAAAATAAGAAGAGGG + Intronic
1150209369 17:63433785-63433807 TAAAGGGTTAAAGAAGAGGAAGG + Exonic
1151006881 17:70448253-70448275 TTAAGGTTTAAATAAAATTAAGG + Intergenic
1153705861 18:7745152-7745174 GCAAGGGTTAAATAAGATAATGG + Intronic
1155471754 18:26199213-26199235 TGAAGAGATACATAAGATGAGGG + Intergenic
1160371588 18:78376664-78376686 CTAAGCATTAAATAAGAGCATGG + Intergenic
925108033 2:1309764-1309786 ATAAGCATTGAATAAGAAGAAGG + Intronic
925835127 2:7937439-7937461 GAAAGATTTAAATAAGATGAAGG - Intergenic
927160392 2:20253114-20253136 TGTACAGTTAAATAAGATGAAGG + Intronic
927799481 2:26084747-26084769 TTTACCCTTAAAAAAGATGAAGG - Intronic
929525624 2:42700246-42700268 TTGAGCGTTAGATAAAAGGAAGG + Intronic
932513419 2:72319285-72319307 TTTACCATTAAATATGATGATGG - Intronic
936695903 2:114948383-114948405 ATAAGGGTAAAATAAGATGCAGG - Intronic
937004489 2:118498982-118499004 TTAAGGGTTAATAAAGATGTAGG + Intergenic
937136934 2:119561474-119561496 TTAAGAATTAAAGCAGATGATGG - Intronic
938700234 2:133871346-133871368 TTAAGTATTAAATATGATGTTGG - Intergenic
939462719 2:142517523-142517545 TTAAGTGGGAAATAAGATGATGG + Intergenic
940655679 2:156485095-156485117 TTCAGCCTTAAAGAAGAAGAAGG - Intronic
941848676 2:170157893-170157915 AGAAGCGAAAAATAAGATGATGG - Intergenic
942063707 2:172250896-172250918 TTAGGGGTTAAACTAGATGAAGG + Intergenic
942743474 2:179206107-179206129 TAAAATGTTAAATAACATGAAGG + Intronic
943883104 2:193172729-193172751 TTAAGTGTGAAATAACATTATGG - Intergenic
947154254 2:227145524-227145546 TTAAGCGTTAAATAAGATGATGG - Intronic
947234206 2:227922776-227922798 TCAAGTGTTAACTAAGATGTAGG + Intronic
948219332 2:236257146-236257168 ATCAGCGTTAATTAAGAAGATGG + Intronic
1173701258 20:45073881-45073903 GTAAGAATTAAATAAGATCACGG - Intronic
1173955537 20:47029519-47029541 GTAAGCCTTAAATATGAAGAAGG - Intronic
1175363504 20:58433691-58433713 TTAAGGATTAAATGAGATGATGG + Intronic
1180626549 22:17197670-17197692 TTGAGGGTTAAATGAGATTATGG - Intronic
949658078 3:6244438-6244460 TCAAGTGTTGGATAAGATGAGGG - Intergenic
953778924 3:45848427-45848449 GTAAGCCTTAAATAACATCATGG - Intronic
955350465 3:58189640-58189662 GTAAAGTTTAAATAAGATGATGG - Intergenic
957350115 3:79013776-79013798 ATGAGCATTAAATAAGATAATGG + Intronic
958872523 3:99577985-99578007 TTAAGCCTTAAATGTGCTGATGG + Intergenic
959249599 3:103925090-103925112 TGAAGAGTTAAATAAGATGAGGG - Intergenic
959734866 3:109647494-109647516 GTAAGAAATAAATAAGATGATGG - Intergenic
960287307 3:115844234-115844256 TTAAGAGTTAAATTAGTTAAGGG - Intronic
963561168 3:146866986-146867008 TTAAGTGTCAAATATTATGAAGG - Intergenic
963901606 3:150738304-150738326 TTAAGCTTCAAATTAGAAGAAGG + Intergenic
966188182 3:177247114-177247136 GTAGGAGTTAAATAAGTTGAGGG + Intergenic
966354405 3:179064339-179064361 TTTAGGATTAAATGAGATGATGG - Intronic
968327580 3:197833135-197833157 TTAAGTCTTAAATAAACTGATGG - Intronic
973123335 4:46551558-46551580 ATAAACATTAAATAAGATTATGG - Intergenic
973645739 4:52949779-52949801 TTAAGCCCTAAATAAAAGGATGG - Intronic
975761404 4:77624011-77624033 TTAAGAGGTAAAGAAAATGAGGG + Intergenic
976212113 4:82681771-82681793 TTAAAAGTTAAAAAAAATGAGGG + Intronic
977077442 4:92473528-92473550 TTAAGCGTAAAGTTAGATGTAGG + Intronic
978237091 4:106472696-106472718 TAAATCCTTAAAAAAGATGAGGG - Intergenic
978939320 4:114417447-114417469 TTAAGCATTACCCAAGATGAAGG - Intergenic
983074133 4:163304208-163304230 GTAAGTGTCAAATAAGATAAGGG + Intergenic
983381022 4:166993591-166993613 TTATACGTTAAATAAAAGGAAGG - Intronic
983917644 4:173309628-173309650 TTAAGCGTTCCAGAAAATGAGGG - Intronic
986131349 5:4934758-4934780 CTGAGAATTAAATAAGATGATGG + Intergenic
988816950 5:34843513-34843535 TTAAGCCTTGAATAACATTAAGG - Intronic
988873995 5:35423558-35423580 TTAAATGTTTGATAAGATGAAGG + Intergenic
989200861 5:38762010-38762032 GTGAGGGTTAAATAAGATAATGG - Intergenic
992288499 5:75260714-75260736 GAAAGCATTAAACAAGATGAGGG + Intergenic
993072963 5:83188797-83188819 TGTAGAGTTAAATAAGAAGAGGG + Intronic
994526074 5:100905686-100905708 TTAAGCTTTAAATTACATTAGGG + Intergenic
997829525 5:137137943-137137965 TTGAGTGTTCAATAAAATGATGG - Intronic
1004150212 6:13111873-13111895 TTAACAGTTAAAAAAAATGAAGG - Intronic
1008213419 6:48754655-48754677 TTAAAAGTAAAATAATATGAAGG - Intergenic
1010230175 6:73527553-73527575 ATAAGGATTAAATAAGATAATGG + Intergenic
1010663139 6:78594694-78594716 TTAATAGCTAAATAAGTTGAAGG + Intergenic
1012292365 6:97472936-97472958 GTAAGGATTAAATAAGATAATGG + Intergenic
1012456198 6:99408456-99408478 GTAAGGATTAAATTAGATGATGG - Intronic
1013845310 6:114443834-114443856 TAAAGTATTAAAAAAGATGAAGG + Intergenic
1014047545 6:116909834-116909856 TTAAGATTTAAATAAGCTGGAGG - Intronic
1014597469 6:123362581-123362603 TTAAGCCTTAAATAAGAGATGGG - Intronic
1014652637 6:124059435-124059457 GTAAGGGTTAGATAAGGTGAAGG - Intronic
1015534191 6:134250757-134250779 TTAAGGGTTAAAAAAAATGGGGG - Intronic
1015718572 6:136216853-136216875 TTGAGCATTAAATGAGATCATGG + Intergenic
1016021540 6:139241328-139241350 TTTAGCATTAATTGAGATGAGGG + Exonic
1016179635 6:141128809-141128831 TTAAGTGTAAAATTAGCTGAAGG - Intergenic
1019813080 7:3179258-3179280 TTGAGCATGAGATAAGATGACGG - Intergenic
1021907641 7:25351627-25351649 ACTAGCGTTAAATAAAATGATGG + Intergenic
1022605828 7:31813075-31813097 TTAAGCATTCAATAAAATGGTGG + Intronic
1023134298 7:37035693-37035715 TTAAGCCTTGAATAACATCATGG - Intronic
1023181970 7:37493746-37493768 ATAAGAGTTACATAAGTTGAGGG + Intergenic
1023458825 7:40370921-40370943 CTGAGAGTTAACTAAGATGAAGG - Intronic
1023781230 7:43657416-43657438 TTAAGTTTTAAATTAGAAGATGG + Intronic
1024921348 7:54558475-54558497 TTTAGCATTAAATGAGATAATGG + Intronic
1025617273 7:63131713-63131735 TTAAACGTTAAAAAAGTGGAGGG + Intergenic
1025966411 7:66277007-66277029 TAAAGCGTTAAATAATATGGTGG + Intronic
1028571842 7:92297599-92297621 TTAAGAGTGAAATAAGTTTAGGG - Intronic
1029411299 7:100413051-100413073 TTAGGCTTTGATTAAGATGATGG - Intronic
1030618127 7:111760031-111760053 TTAAGCTAAAATTAAGATGATGG + Intronic
1030679763 7:112422719-112422741 TTAAGAGTTAAATGAGAGGGAGG - Intergenic
1030738671 7:113082748-113082770 TCCAGTGCTAAATAAGATGAAGG + Exonic
1031549760 7:123094400-123094422 TTAAACCTTAAACAACATGAGGG + Intergenic
1035889201 8:3325379-3325401 TTAAGTGTGAAATAAAATGAAGG - Intronic
1035988278 8:4458758-4458780 TTATGCATTGAATAAGATAACGG + Intronic
1038466934 8:27772868-27772890 TTTAGGGTTAAATAAGTTAATGG + Intronic
1039341902 8:36659626-36659648 TTTTGCTTTAAGTAAGATGATGG - Intergenic
1041779919 8:61566839-61566861 TTAAGTGTGAAATAACATTATGG - Intronic
1044067678 8:87719022-87719044 TTAAGTGTTATACAAGATAATGG + Intergenic
1044151714 8:88785617-88785639 TTAAGAGTTATATAAAATCATGG - Intergenic
1047096283 8:121629554-121629576 TCAAGAGTCAAATGAGATGATGG + Intronic
1048120826 8:131579749-131579771 TTAAGTGTTTACTAAGATGCTGG - Intergenic
1048195776 8:132330734-132330756 ATAAGGCTTATATAAGATGATGG + Intronic
1049133821 8:140875298-140875320 GAAAGCGTTAATTAAGATGAAGG + Intronic
1050941380 9:11463104-11463126 CTAATCATTCAATAAGATGAAGG + Intergenic
1051279686 9:15429565-15429587 TAAAGTGTTAAATAAGAAAATGG + Intronic
1051453986 9:17231284-17231306 GTAAGAGTTAAATAAGCTGAAGG - Intronic
1051791719 9:20811517-20811539 TTAAGAGTCAAATAAGGTCAAGG - Intronic
1052367067 9:27624229-27624251 TAAATCGTTGAATAGGATGAAGG - Intergenic
1053561954 9:39205560-39205582 TTAAGCTTTAAATAAAATACAGG - Intronic
1053827767 9:42043563-42043585 TTAAGCTTTAAATAAAATACAGG - Intronic
1054135163 9:61413396-61413418 TTAAGCTTTAAATAAAATACAGG + Intergenic
1054602792 9:67143882-67143904 TTAAGCTTTAAATAAAATACAGG + Intergenic
1059642051 9:116226974-116226996 TTAGGCATTAAATATGAAGATGG - Intronic
1060785021 9:126444711-126444733 TTAAATGTTAAAAAAAATGAAGG - Intronic
1186856970 X:13636014-13636036 TTAAGCATGAATTAAGATGGAGG - Intergenic
1190459509 X:50658329-50658351 TTGAGGGGTAAATAAGAGGAGGG - Intronic
1190824023 X:54000529-54000551 TTAAGTGTTCAATCAGATGCTGG - Intronic
1191189337 X:57649944-57649966 TTAAGCCTTAATCAAGATAATGG - Intergenic
1192054952 X:67764042-67764064 TTTAGTGTTACATAAAATGATGG + Intergenic
1193200818 X:78688245-78688267 ATAAGGATTAAATAAGATGATGG + Intergenic
1193908664 X:87275420-87275442 TTCATCGTTAAATATGATTATGG + Intergenic
1194939317 X:99990210-99990232 TCAAGAATTAAATGAGATGATGG - Intergenic
1196558392 X:117118877-117118899 TTTAGCATCAAATAAAATGATGG - Intergenic
1196576735 X:117326931-117326953 TTAAATGTTAGAAAAGATGATGG - Intergenic
1196974715 X:121146609-121146631 GTCAGCCTTAAATTAGATGAAGG + Intergenic
1197859409 X:130953708-130953730 ATAAATGTTAAATAATATGAAGG - Intergenic