ID: 947154259

View in Genome Browser
Species Human (GRCh38)
Location 2:227145569-227145591
Sequence GGTCACACCATTCCAAAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 3, 3: 10, 4: 129}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947154254_947154259 22 Left 947154254 2:227145524-227145546 CCATCATCTTATTTAACGCTTAA 0: 1
1: 0
2: 1
3: 15
4: 173
Right 947154259 2:227145569-227145591 GGTCACACCATTCCAAAGGATGG 0: 1
1: 0
2: 3
3: 10
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947154259 Original CRISPR GGTCACACCATTCCAAAGGA TGG Intronic
902464273 1:16605837-16605859 TGTCACATCATTCCACAGTAGGG + Intronic
905567245 1:38975360-38975382 TGTCATACCATTTCAAAAGATGG - Intergenic
906469285 1:46114232-46114254 AGCCACATCATTCCAAATGAAGG + Intronic
909203709 1:72725900-72725922 GGTCACTACACTCCAATGGATGG - Intergenic
913546160 1:119871213-119871235 GGTCACACCATTCCAGGGAGCGG + Intergenic
920512328 1:206560382-206560404 GGTCTCCCCATTTCATAGGAAGG + Intronic
922249577 1:223836307-223836329 GGAAACACAATTCCGAAGGAAGG + Intronic
923061892 1:230483426-230483448 GGACACACTACTCCAAAGTACGG + Intergenic
1063275115 10:4557566-4557588 GGTCACTCCACTCCAAAGGGTGG + Intergenic
1066119260 10:32267927-32267949 GGTCAAATATTTCCAAAGGAAGG + Intronic
1067294246 10:44965722-44965744 GGGCACACCATCCCAGGGGAGGG - Intronic
1070647899 10:78214211-78214233 GGCCATCCCATTCCACAGGAGGG + Intergenic
1070826794 10:79394925-79394947 CCTCACACCACTCCAAAGGCGGG + Intronic
1072795907 10:98354484-98354506 GGCCACACCATTTAAAAGAAAGG + Intergenic
1072837822 10:98735641-98735663 GGTCACGCCAATGCAAAAGATGG - Intronic
1074949500 10:118316851-118316873 GATTACAGTATTCCAAAGGAGGG + Intronic
1077390695 11:2299490-2299512 GGACACAGCTTTCCAGAGGAGGG + Exonic
1082209927 11:49486847-49486869 GAGCACACCATTACAAAGTATGG - Intergenic
1083476262 11:62917536-62917558 GTTCACCCCATTCCACAGAAGGG - Intronic
1090452787 11:126821372-126821394 GGTAAGCCCTTTCCAAAGGAAGG - Intronic
1091704711 12:2685972-2685994 GGAGACAACATTCCAAAGGCAGG + Intronic
1091711284 12:2742311-2742333 GGAGACAACATTCCAAAGGCAGG + Intergenic
1092913767 12:13171527-13171549 GGACACCCCAGTCCACAGGAGGG - Intergenic
1097472724 12:60015361-60015383 GTGAACACCATTCCACAGGAAGG + Intergenic
1102863555 12:116356866-116356888 GGCCACACAATCCCAAATGAAGG + Intergenic
1103551881 12:121743931-121743953 AGTGACACCAATCCAGAGGAAGG - Intronic
1105221068 13:18327963-18327985 GGTCACCCCATTCCAAAGCATGG - Intergenic
1107242273 13:38250770-38250792 GGTAATACAATACCAAAGGAAGG + Intergenic
1107962361 13:45569919-45569941 AGTCACTTCATCCCAAAGGAGGG - Intronic
1108178074 13:47814488-47814510 GTTTACAATATTCCAAAGGAAGG + Intergenic
1121560453 14:94871174-94871196 GGACACAACATTTCAACGGAAGG - Intergenic
1122080078 14:99261040-99261062 GTTCACCCGATTCCAAAGAACGG + Intronic
1122932702 14:104942018-104942040 GGGGACAACATCCCAAAGGATGG + Exonic
1125998090 15:44183395-44183417 GGGCCCACCACTCCACAGGAAGG + Intronic
1127545413 15:59990119-59990141 GGTCACACAATAGCAAAGCAGGG - Intergenic
1129165252 15:73773597-73773619 GTTCACAGCATTCCGAAGTAAGG - Intergenic
1129817124 15:78565279-78565301 GGTCGCACCTGCCCAAAGGAAGG + Intergenic
1129931270 15:79412806-79412828 GGTCACAACACTCCAATGGGTGG - Intronic
1132138615 15:99369409-99369431 GCTCACACAATTGCAAAGGCTGG + Intronic
1133658933 16:7895920-7895942 GCCCACACCCTTCCAAAGAAGGG - Intergenic
1135566157 16:23512640-23512662 GTTCAAACCAGTCCAAAGAATGG - Intronic
1141053590 16:80795469-80795491 GGTCACACCACTCCAGTGAAAGG - Intronic
1144726971 17:17506941-17506963 GGTCACCCCAGCCCAGAGGACGG + Intronic
1148807122 17:50269526-50269548 GGTCACCTCATTGCCAAGGAGGG - Intergenic
1152223608 17:79082520-79082542 GGTCACACCAGCACAGAGGAAGG + Intronic
1152656244 17:81520310-81520332 GGTCACACCATGCCCAGGGAAGG + Intronic
1153557068 18:6326058-6326080 GATCACACTATTCTGAAGGAAGG + Intronic
1155844958 18:30694840-30694862 GGTCACAACACTCCAGTGGATGG + Intergenic
1157584261 18:48791127-48791149 GTTGACACCAGGCCAAAGGAGGG + Intronic
1161043787 19:2123762-2123784 GGCCACACCTTTCCACAGGCGGG - Intronic
1162382679 19:10340724-10340746 GGTCACTGCATTCCAAGGGAAGG + Intergenic
1162474515 19:10891888-10891910 GTTCACACAATGGCAAAGGAGGG + Intronic
1163265225 19:16216835-16216857 GGTCACAACACTCCAATGGGTGG + Intronic
1165242197 19:34477828-34477850 AGTCCCACTGTTCCAAAGGAGGG - Intergenic
1166885839 19:45960610-45960632 GGTGACAGAATTCCAAAGGGGGG + Intronic
1166946425 19:46399818-46399840 GGTCGCACAATGCCCAAGGATGG - Intergenic
926308893 2:11660188-11660210 AGTTACACCATTGCAAAGGGAGG + Intronic
932313968 2:70767630-70767652 GGTCCCACCATCCCCAAGCAGGG + Intronic
932640236 2:73438466-73438488 GGTGACACCATTAGAAAGTAGGG + Intronic
934182989 2:89644505-89644527 GGTCACCCCATTCCAAAGCATGG + Intergenic
934293275 2:91718692-91718714 GGTCACCCCATTCCAAAGCATGG + Intergenic
937138110 2:119572886-119572908 GGTGACTCCATTCCAAAGCCAGG + Intronic
938681743 2:133699313-133699335 GCTCTCACCATTCCAGAAGAGGG + Intergenic
940097412 2:149993331-149993353 GGACACACTATTCCAAAATATGG - Intergenic
941424811 2:165329294-165329316 GGTCACACCTTTGTGAAGGATGG + Intronic
943427307 2:187752487-187752509 GGTCACACTAATGCAAAGGTGGG + Intergenic
944140373 2:196449868-196449890 AATCACACCATTGCAAAGGGTGG - Intronic
947154259 2:227145569-227145591 GGTCACACCATTCCAAAGGATGG + Intronic
948441658 2:237995119-237995141 GGTCACACTATTCCTACGTAAGG - Intronic
1169560915 20:6799861-6799883 GGTGTCATCATTCCAATGGAAGG + Intergenic
1170728954 20:18955669-18955691 GGTCACACCAGTCGACAGCATGG - Intergenic
1170979198 20:21195394-21195416 GTTGTCACCATTCCTAAGGATGG + Intronic
1174845271 20:53937282-53937304 GTTCACCCCATTCTAAAGTAAGG - Intronic
1177164543 21:17585368-17585390 GGTCACACAATTCGAAAACATGG - Intronic
1181769339 22:25113982-25114004 GGTCACACCACTCCCCAGGGTGG - Intronic
1183481746 22:38069108-38069130 GGACTCACCATTGCACAGGATGG - Exonic
1184528152 22:45037658-45037680 GGTGACAGCATTCCAATGGCAGG + Intergenic
1184528294 22:45038591-45038613 GGTGACAGCATTCCATGGGAAGG + Intergenic
1184566529 22:45295352-45295374 GTTCACATCATTCCAAAAGGTGG + Intronic
949754334 3:7392089-7392111 GTTCAAACCACACCAAAGGAGGG - Intronic
951841851 3:27043313-27043335 GACCAAACCATACCAAAGGAGGG + Intergenic
952732782 3:36656776-36656798 ATTGACACCATTCCACAGGATGG + Intergenic
958664603 3:97119924-97119946 AGTCTCAGCATTCAAAAGGAGGG - Intronic
959332416 3:105022983-105023005 GGACAGACTATTTCAAAGGAGGG + Intergenic
959421696 3:106136268-106136290 GGTCACTACATTCCAATGGGTGG - Intergenic
960268354 3:115647289-115647311 TTTCTCACCATTCCAGAGGATGG - Intronic
965612301 3:170557259-170557281 GGGCTCCACATTCCAAAGGATGG - Intronic
968386194 4:140517-140539 GGCCAAACCATACCAAAGGAGGG - Intronic
968575900 4:1366008-1366030 TGTGACGCCATTCCACAGGAGGG + Intronic
971884927 4:32432232-32432254 GGTCACAACATTCCAAGGGGTGG - Intergenic
972422198 4:38898730-38898752 GGAAAGACTATTCCAAAGGAAGG + Intronic
972976270 4:44640532-44640554 GGTCCCACCCTTCCCATGGAAGG - Intronic
973874522 4:55203537-55203559 GATCACATGATTCCAAAAGATGG + Intergenic
976369314 4:84268618-84268640 GGTGACACCTTTGCCAAGGATGG + Intergenic
980792040 4:137632536-137632558 GGCCACAGCATTTCAAAGGGTGG - Intergenic
980938189 4:139246316-139246338 TGTCCCAACAGTCCAAAGGAGGG + Intergenic
982242995 4:153319406-153319428 GATTAAACCATTCCAAAGGCAGG + Intronic
982832881 4:160086050-160086072 GGTCACACTGATGCAAAGGATGG + Intergenic
983699666 4:170576818-170576840 AGTGACAGGATTCCAAAGGAGGG - Intergenic
987722380 5:21654695-21654717 GGTGACACCTTTCCAAAGAGAGG - Intergenic
987842271 5:23237098-23237120 GGTCAAACAGTACCAAAGGAGGG + Intergenic
988620097 5:32814560-32814582 CATCATACCATTCCCAAGGAGGG + Intergenic
988894441 5:35656923-35656945 GCTCACTACATTCCATAGGAAGG - Intronic
994643002 5:102433662-102433684 GGTCACAACACTCCAATGGACGG + Intronic
994727597 5:103454586-103454608 GGTCACTCCTTTCAAAATGAGGG - Intergenic
997280721 5:132643061-132643083 GGTCAGAGCTTTCCAAAGGTGGG - Exonic
997413154 5:133705434-133705456 GGTCCCACCATTCCAGAAGGAGG - Intergenic
999020778 5:148163481-148163503 GGCCACACCAATGCAAGGGATGG + Intergenic
1001032467 5:168272713-168272735 GATCCCAGCATTCCTAAGGAAGG + Intergenic
1001787275 5:174424567-174424589 GGTCTCACCATGCCAGAGGCTGG + Intergenic
1013799056 6:113919543-113919565 GGTGACACCACTCTCAAGGAGGG + Intergenic
1014081611 6:117292917-117292939 GGTCACACTAATCAAAAGTAAGG - Intronic
1016814285 6:148289349-148289371 GCTCACGCCTTTCCACAGGAAGG - Intronic
1016894971 6:149042563-149042585 GGTCACTCCACTTCAAAGGAAGG + Intronic
1020587554 7:10088135-10088157 GGACACACTGTTCCAAAAGATGG + Intergenic
1022877877 7:34553345-34553367 GGTCACAACACTCCAATGGGTGG - Intergenic
1022968221 7:35493955-35493977 CATCACACCATACCACAGGAAGG + Intergenic
1024329079 7:48138890-48138912 GGCCAAACCAAGCCAAAGGAGGG + Intergenic
1030922710 7:115412067-115412089 AGTCACATCTTTCCACAGGAAGG - Intergenic
1031391114 7:121216343-121216365 GGTCACATCCTTCAAAATGAGGG - Intronic
1034309533 7:150074663-150074685 GGGCACACTATTCCAAAGGTTGG + Intergenic
1034797325 7:154025978-154026000 GGGCACACTATTCCAAAGGTTGG - Intronic
1035684684 8:1514667-1514689 TGTCACCCCATTCTAAAGGAGGG + Intronic
1048029396 8:130616682-130616704 GGTCACTACACTCCAATGGATGG - Intergenic
1051855916 9:21565242-21565264 AGCAACACCATTACAAAGGAAGG - Intergenic
1053283785 9:36837955-36837977 GTACACATCATTCCAAAAGAAGG + Exonic
1055122787 9:72682042-72682064 GGACTCACCAATCCAAAAGAGGG - Intronic
1056339996 9:85619281-85619303 AGTTACACCATTCCAGAAGAGGG - Exonic
1060432314 9:123561081-123561103 GCTTGCACCATTTCAAAGGATGG - Intronic
1061722354 9:132560416-132560438 GGTAACACCAGTCCCAAGGTGGG - Intronic
1185853529 X:3510977-3510999 GGTCCTACCATTTTAAAGGAAGG - Intergenic
1186559021 X:10590468-10590490 GGTCGCAGCATTCCAGGGGAGGG + Intronic
1189558035 X:42165636-42165658 GGTCACAACACTCCAATGGGTGG + Intergenic
1189960818 X:46323387-46323409 GGACACACTACTCCAAAAGATGG - Intergenic
1190950686 X:55140062-55140084 GGGCACACCGATGCAAAGGATGG - Intronic
1192982937 X:76366674-76366696 GGTCACAATAATCCAAAAGATGG + Intergenic
1194469997 X:94282316-94282338 GCTGACACTATTCCAAAAGATGG - Intergenic
1195968586 X:110451131-110451153 GTACACACCACTCCAGAGGATGG - Exonic
1196584177 X:117409876-117409898 GGTCACAGCACTCCAATGGGTGG - Intergenic
1197370523 X:125621149-125621171 GGTCACAACATTCCAATAGGTGG + Intergenic
1197820961 X:130540520-130540542 GGTCTCACAACTCCAAAGAAAGG - Intergenic
1199707089 X:150437126-150437148 GGTCACAACACTGCAATGGATGG + Intronic
1200809909 Y:7473550-7473572 GGTCTTACCATTTTAAAGGAAGG + Intergenic