ID: 947156290

View in Genome Browser
Species Human (GRCh38)
Location 2:227164987-227165009
Sequence CGGGGATGCCCCGGAACAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 105}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947156281_947156290 9 Left 947156281 2:227164955-227164977 CCCGGGACAGGCAGCGAGCGGAA 0: 1
1: 1
2: 1
3: 7
4: 133
Right 947156290 2:227164987-227165009 CGGGGATGCCCCGGAACAGGTGG 0: 1
1: 0
2: 1
3: 4
4: 105
947156282_947156290 8 Left 947156282 2:227164956-227164978 CCGGGACAGGCAGCGAGCGGAAG 0: 1
1: 0
2: 0
3: 8
4: 166
Right 947156290 2:227164987-227165009 CGGGGATGCCCCGGAACAGGTGG 0: 1
1: 0
2: 1
3: 4
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947156290 Original CRISPR CGGGGATGCCCCGGAACAGG TGG Intronic
900173426 1:1281499-1281521 AGGGGATGGCCCAGAAGAGGGGG + Exonic
901660759 1:10796459-10796481 GGGGGGTGCACCGGGACAGGGGG + Intronic
902241884 1:15095069-15095091 CGGGGATGCCCCTGATGAGGGGG + Intronic
902995568 1:20222354-20222376 TGGGGAGGCCCCTGAACTGGGGG + Intergenic
903560034 1:24220283-24220305 CGGGGAGGCCCCTGAGGAGGTGG - Intergenic
903828586 1:26161708-26161730 CCAGGATGCCCCGGAAGCGGCGG + Exonic
905692849 1:39955524-39955546 TGGGGGTGCCCTGGGACAGGGGG + Intronic
915457153 1:156048497-156048519 CAGTGCTGCCCGGGAACAGGTGG - Exonic
915940751 1:160116748-160116770 AGGGCATGCTGCGGAACAGGAGG + Intronic
920200412 1:204256761-204256783 CGGGGAGGCCCTGAGACAGGTGG + Intronic
920528457 1:206685201-206685223 CGGGGACGCCGGGGCACAGGCGG - Exonic
1066302208 10:34107216-34107238 CAGGGCTGTCCCAGAACAGGCGG - Intergenic
1066648621 10:37635167-37635189 CGGGGATGCCATGGCACAAGTGG + Intergenic
1077287197 11:1772949-1772971 AGGGGCTGCCCAGGCACAGGTGG + Intergenic
1077479418 11:2806654-2806676 TGGGGATCCCCCAGGACAGGTGG - Intronic
1078602582 11:12746881-12746903 CTGGGATGCCACAGACCAGGCGG + Intronic
1078879104 11:15430428-15430450 CAAGGAAGCCCTGGAACAGGAGG + Intergenic
1079118450 11:17656489-17656511 GGGTGATGGCCAGGAACAGGTGG + Intergenic
1084324864 11:68394363-68394385 CGGAGCTGTCCAGGAACAGGGGG + Intronic
1088697416 11:112380357-112380379 CGGAAATGCTCAGGAACAGGAGG - Intergenic
1091671448 12:2454941-2454963 CGGCGCTGCCCCTGCACAGGTGG + Intronic
1093130193 12:15382444-15382466 CAGGGAGGCCCTGGAACAGGAGG + Intronic
1096256946 12:50068838-50068860 GTGGGATGGGCCGGAACAGGGGG - Intronic
1103702538 12:122855330-122855352 CGAGGAGGCCCCGGAAGATGAGG + Exonic
1113911358 13:113842950-113842972 GGGGGAGGCCCCGGGGCAGGTGG - Intronic
1119480529 14:74955299-74955321 CGGGGAGCCCCTGGCACAGGAGG + Exonic
1120229717 14:81829495-81829517 CGGGGGGGCCCCGAAGCAGGGGG + Intergenic
1122922539 14:104885964-104885986 AGGGGGTGCCAGGGAACAGGAGG - Intronic
1123063349 14:105604457-105604479 CGGGGCTGGCCCGGGCCAGGCGG - Intergenic
1123087409 14:105723243-105723265 CGGGGCTGGCCCGGGCCAGGCGG - Intergenic
1124707466 15:31977724-31977746 TGGGGATACCCCTGAGCAGGTGG + Intergenic
1129719820 15:77871956-77871978 CGGGGCTGCTCAGGCACAGGAGG - Intergenic
1132941367 16:2510080-2510102 CGGGGATTTCCAGGAACTGGGGG - Intronic
1133186895 16:4106394-4106416 CGGTGCTGCCGCGGAACAGAAGG - Intronic
1133590602 16:7239209-7239231 CCAGGATGCCCAGGAAAAGGTGG + Intronic
1136276528 16:29182255-29182277 CATGGATGCCCCAGCACAGGAGG + Intergenic
1136493217 16:30624561-30624583 AGGGGCTGCCCAGGAAGAGGAGG + Intergenic
1137514078 16:49127448-49127470 CAGAGATGACCCTGAACAGGTGG - Intergenic
1139424809 16:66873129-66873151 CAGGGCTTCCCCGGAAAAGGTGG + Intronic
1139489819 16:67280128-67280150 CAGGGATGCCTGGGAAGAGGAGG + Exonic
1141753308 16:85974356-85974378 AGGGGATGCTGCGGAAAAGGGGG - Intergenic
1146277626 17:31525267-31525289 CAGGGCTGCCCCAGGACAGGGGG - Intronic
1146832582 17:36082508-36082530 AGAGGAGGCCCAGGAACAGGGGG + Intergenic
1146847062 17:36188820-36188842 AGAGGAGGCCCAGGAACAGGGGG + Intronic
1148200666 17:45748057-45748079 AAGGGATCCCCCGGAACTGGGGG + Intergenic
1148789630 17:50166099-50166121 CGGGGAGGCCCAGGATGAGGGGG + Intronic
1148795999 17:50197035-50197057 CGAGGATTGCCCGGAACAGCTGG - Exonic
1152520177 17:80851326-80851348 GTGGGATGGTCCGGAACAGGAGG + Intronic
1153765085 18:8367295-8367317 CGGGGCGGGCCCAGAACAGGCGG - Intronic
1156386426 18:36609298-36609320 AGGGGAGGCCCAGGGACAGGTGG + Intronic
1161699669 19:5787803-5787825 CGGGGAGGCCCCGAGAGAGGAGG - Intronic
1161900373 19:7114245-7114267 GGGGGATTCCATGGAACAGGTGG + Intronic
1165240951 19:34466914-34466936 TGGTGATGCCCCGGAAAAAGTGG + Exonic
1166524715 19:43504010-43504032 CGAGGAGTCCCGGGAACAGGAGG - Exonic
1167456685 19:49599893-49599915 CTGGGGAGCCCCGGAAGAGGGGG - Exonic
925041233 2:733084-733106 CGGGGAAGTCACGGCACAGGGGG + Intergenic
927337513 2:21941982-21942004 CAGGGATGCCCCAGAGCATGTGG - Intergenic
929604261 2:43224871-43224893 CGCGGAGGCCGAGGAACAGGAGG + Exonic
931253396 2:60551861-60551883 CGCGGCAGCCCCGGAGCAGGCGG - Intronic
934990261 2:98915443-98915465 CAGGGATGCCCGGGGACTGGTGG + Intronic
946407993 2:219502329-219502351 CGTGGCTGCCCTGGAGCAGGCGG + Intronic
946971204 2:225093724-225093746 CAGGGAAGCCCTGGGACAGGAGG - Intergenic
947156290 2:227164987-227165009 CGGGGATGCCCCGGAACAGGTGG + Intronic
948620940 2:239234218-239234240 CAGCGATGCCCAGGAACAGTGGG - Intronic
1174112184 20:48204648-48204670 CCGGGATGTCCCAGCACAGGAGG + Intergenic
1175856065 20:62121878-62121900 CGGGGCTGCCCGGGAACACCCGG + Intergenic
1176105570 20:63384247-63384269 CCGGGATACCCCGTAACAGGTGG + Intergenic
1179630159 21:42672858-42672880 CGGGGATGCCACCGCACAGCAGG - Intronic
1181368956 22:22401273-22401295 AGGGGATGCCCAGGAACAGAGGG - Intergenic
1183650657 22:39151788-39151810 AGGGGATGCCCCAGCGCAGGGGG + Intronic
1184155208 22:42662586-42662608 CGGGGAGGCCCGGGAGCGGGAGG + Intergenic
1184428671 22:44428341-44428363 CTAGGAGGCCCCGGAAGAGGAGG + Intergenic
1184496880 22:44847124-44847146 TGGGGGTGCCCCGGAACACCAGG - Intronic
1184645445 22:45892446-45892468 CAGGGAAGCCCGGGAGCAGGGGG - Intergenic
1185156051 22:49194151-49194173 CTGGGATCCCCCGGAGGAGGTGG - Intergenic
953606798 3:44417732-44417754 CCTGGATGCCCCTGGACAGGAGG + Intergenic
961037104 3:123650046-123650068 GAGGGGTTCCCCGGAACAGGGGG + Intronic
964438254 3:156675540-156675562 CGGGGACGCCCGGGAACACCCGG + Intronic
968090509 3:195895804-195895826 CCGGGATGCCTCGGAGGAGGGGG - Intronic
980053952 4:128062062-128062084 CGAGGACGCCCGGGAAGAGGTGG + Intronic
980065407 4:128182569-128182591 CAGGGATGCCCAAGAAGAGGGGG - Intronic
984162360 4:176269173-176269195 CCGGGATGCTCCTGAACAGCTGG + Exonic
987225036 5:15831362-15831384 TGGGGAAGACCTGGAACAGGAGG + Intronic
992894652 5:81235572-81235594 CCGGGATGCCCAGGAAGAGCAGG + Intronic
993649835 5:90506626-90506648 CGATGATGCCGCAGAACAGGAGG + Exonic
997146204 5:131436318-131436340 CAGAGCTGCCCCGGAATAGGTGG - Intronic
999759061 5:154686293-154686315 CGGGGATGCTCCGGAAGAGGTGG + Intergenic
1001906665 5:175478792-175478814 CGGGGATGCCTCGGGCCGGGGGG + Intronic
1002851125 6:997346-997368 GTGGGATGCCCGGGAACATGGGG - Intergenic
1005610496 6:27519234-27519256 CCGGGCTGCCCCGATACAGGGGG - Intergenic
1006671393 6:35731817-35731839 CGGGGCTGCCCGGGAAGGGGCGG - Intergenic
1019422436 7:957326-957348 GGAGGAGGCCCCGGAACAGCAGG - Intronic
1019670812 7:2277298-2277320 TCGGGATGCCCAGCAACAGGAGG + Intronic
1022410457 7:30135443-30135465 CGGGGAAGCCCCGGGCCGGGCGG + Intronic
1023844132 7:44111692-44111714 CAGAGAGGCTCCGGAACAGGCGG - Intronic
1029460989 7:100693896-100693918 CGGGGATGGGCCGGAGCGGGCGG + Intergenic
1034153478 7:148935522-148935544 CTGGGATGCCCAGCAACAGAAGG + Intergenic
1034500601 7:151448319-151448341 CGGGGCTGACCCGGCGCAGGAGG - Intergenic
1034970770 7:155417925-155417947 GGGGGCTGCCCCTGAACAGTGGG - Intergenic
1035563721 8:627837-627859 CTGGGGAGCCCAGGAACAGGAGG + Intronic
1037815479 8:22109541-22109563 CGGGGCCGCCCTGGAACTGGGGG + Intergenic
1042155780 8:65842345-65842367 GGGGGATGCCCCGAAACGGTGGG - Intergenic
1049803916 8:144530399-144530421 CGGGGGCGCCCGGGGACAGGAGG - Exonic
1050181959 9:2932867-2932889 CAGGGATGCCCCAGGGCAGGAGG - Intergenic
1053076659 9:35139551-35139573 AGGTGAGGCCCTGGAACAGGTGG - Intergenic
1056806554 9:89733347-89733369 CGGGGATGCCCCTGGACCTGCGG + Intergenic
1056930129 9:90867343-90867365 CGCGGCTGCCCAGGAACAGCAGG - Intronic
1062095309 9:134700087-134700109 GGTTGATGCCCCGGAAGAGGGGG - Exonic
1062621486 9:137424167-137424189 TTGGGATGCGCAGGAACAGGCGG - Intronic
1203376815 Un_KI270442v1:383286-383308 CTGGGACGGGCCGGAACAGGGGG - Intergenic
1198468973 X:136928710-136928732 AGGGGGTGGCCGGGAACAGGTGG - Intergenic