ID: 947156361

View in Genome Browser
Species Human (GRCh38)
Location 2:227165448-227165470
Sequence ACTTGGAATTTGAGTGAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 232
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 214}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947156361 Original CRISPR ACTTGGAATTTGAGTGAAAC TGG Intronic
900688836 1:3966985-3967007 ACTTGGAATGTGGGTGGGACCGG + Intergenic
905126666 1:35720120-35720142 ACTTGGAATCAAATTGAAACTGG - Intergenic
907097831 1:51797714-51797736 ACTAGGATTTTGAGTGAAATGGG - Intronic
908586700 1:65577736-65577758 ACTTGGACCTTGAGTGAATCAGG + Intronic
908706126 1:66956871-66956893 ACATGGATTTTGAGTGATGCAGG + Intronic
908914568 1:69111120-69111142 ATGTGGAATTTGAATGAGACTGG + Intergenic
911499696 1:98669596-98669618 AATTGGAATCTGATTTAAACAGG + Intronic
915484911 1:156213403-156213425 ACCTGAAATTTTAGTGAAAACGG - Intronic
919485095 1:198135821-198135843 ACTTGGAGTTTGACTCAAATTGG + Intergenic
919876621 1:201873931-201873953 ACTTAGAATTTGAGAGACAGCGG - Intronic
921455650 1:215367829-215367851 ACTTAGACTTTGAAAGAAACTGG + Intergenic
923121079 1:230992135-230992157 GCTTGCACTCTGAGTGAAACGGG - Intronic
1065498415 10:26353963-26353985 ACTTGGCATCAGAATGAAACTGG + Intergenic
1065885724 10:30075197-30075219 CCTTGGAATCTGAATGAAACAGG + Intronic
1066973863 10:42345543-42345565 ACTTTAACTTTGAGTCAAACAGG + Intergenic
1068478317 10:57556644-57556666 AATTGGTATTTGAATGATACAGG + Intergenic
1069578918 10:69551872-69551894 ACTTAGAATTCAAGAGAAACTGG - Intergenic
1069767040 10:70870107-70870129 ACTTGGGACTTGAGAGACACTGG + Intronic
1071807795 10:89143080-89143102 ACTTGGGATTTTTGTCAAACAGG + Intergenic
1072788002 10:98297155-98297177 ACCTGCAATTTGAGAAAAACAGG - Intergenic
1072854889 10:98936318-98936340 ACTTGGAACTCTAGTGAGACAGG - Intronic
1073677656 10:105666601-105666623 ACTTGGAATCAGAGTTAGACAGG - Intergenic
1073715360 10:106100410-106100432 ACTTGGGAGTTGAGTCAAATAGG - Intergenic
1075052471 10:119193012-119193034 ACTTGGACTTTGAGAGATAATGG - Intergenic
1075081223 10:119385180-119385202 ACTTTGACTTTGGGTGAAATGGG + Intronic
1075464592 10:122642203-122642225 ACTTGGTATTTGAGAGAATCTGG + Intronic
1076608889 10:131708047-131708069 ACTTGGACTCTGGGTGAAAGTGG + Intergenic
1077359033 11:2132445-2132467 CCTTGGACTTTGAGTCAAATTGG - Intronic
1080044455 11:27794547-27794569 CTTTGGAATTTGAGTGAGATGGG + Intergenic
1081932007 11:46878028-46878050 CCTGGGAATTTGAGTGAGAAAGG - Intronic
1085071659 11:73552153-73552175 ATTTGGAATTGGACTAAAACTGG + Intronic
1085599524 11:77842599-77842621 ACTTGGGATTGGAGAGAAACAGG + Exonic
1086072246 11:82812211-82812233 ACTTGAAAGGTGAGTGAAAGTGG - Intergenic
1086669504 11:89529902-89529924 ACTTCAAAATTGAGTGAAATGGG - Intergenic
1088371886 11:109099237-109099259 ACTTGGAAGTAGAGCAAAACAGG - Intergenic
1088439674 11:109855876-109855898 ACTTGGCTGTTGGGTGAAACAGG + Intergenic
1089035032 11:115380179-115380201 ATTTGGAATATAAGTCAAACAGG + Intronic
1091333682 11:134750975-134750997 ACCTGCAATGTCAGTGAAACAGG + Intergenic
1092162275 12:6322362-6322384 ACCTGGAATTCAAGTGAAAGAGG + Intronic
1093021238 12:14206270-14206292 TCTTGGAACTTGAATGAAGCAGG - Intergenic
1093434421 12:19119822-19119844 AATTGGAAATTGAGGGAAATTGG + Intergenic
1094221296 12:27996443-27996465 ACTTGGCTTATGAGTGAAAGTGG + Intergenic
1094685710 12:32712230-32712252 ACTTGGGCTTTTAGTGAAATGGG - Intronic
1095441596 12:42243503-42243525 AATTGGAATTTGAGAGAAAATGG + Intronic
1098739105 12:74148405-74148427 ACTTTGACTCTGAGTGAAATGGG - Intergenic
1099203359 12:79700840-79700862 ATTTGGATTTTAAGTGAAATAGG - Intergenic
1099363909 12:81743746-81743768 ATTTGTAAATTCAGTGAAACTGG - Intronic
1099386603 12:82020118-82020140 ATTTGCAATATGAGTGAAACTGG - Intergenic
1099657162 12:85508386-85508408 ACTTCAAATCTGAGTGAAATGGG + Intergenic
1102940169 12:116933958-116933980 CCTTGGGATTTTAGTGAAATTGG + Intronic
1107792326 13:44015058-44015080 ACTCTGAATTTGAGTGCCACTGG - Intergenic
1109206730 13:59490923-59490945 ATTTGGCTTTTGAGTTAAACAGG - Intergenic
1109913308 13:68945713-68945735 ACTCAGTACTTGAGTGAAACAGG - Intergenic
1112238046 13:97653760-97653782 ACTTTGAACTTGAGTGCAATTGG - Intergenic
1115914606 14:38297934-38297956 TGTTGGAATTGGAGTGAATCTGG + Intergenic
1116786417 14:49293685-49293707 GGTTGGACTTTGAGTGATACAGG + Intergenic
1119926237 14:78496879-78496901 ACTTGTACTTTGAGTTAAAATGG + Intronic
1120489893 14:85164158-85164180 ACTTGGTATTAGGGTGAGACTGG - Intergenic
1120895643 14:89529496-89529518 ACTTGTAATTTCTGGGAAACTGG + Intronic
1121364665 14:93297925-93297947 GCTTGGAATCTGAGTGTAAGGGG + Intronic
1123194401 14:106602651-106602673 ATTTGAAATTTGTGAGAAACGGG - Intergenic
1123803528 15:23847788-23847810 ACTTGGAAATTGAATGCAAAGGG + Intergenic
1123834491 15:24174869-24174891 ACTAGGAATTTGGGGGAAAATGG - Intergenic
1123870144 15:24563054-24563076 ACTAGGAATTTGCGGGAAAATGG - Intergenic
1124094148 15:26633117-26633139 ACTTGGGATTTGAGAGCAAAGGG - Intronic
1130783287 15:87068427-87068449 TTTTGTAATTTTAGTGAAACAGG - Intergenic
1130928665 15:88404389-88404411 TCTTGGACTTTCAGTGAAAAAGG + Intergenic
1131368012 15:91855615-91855637 CCTTGGAATTTGAGGGATAGGGG + Intronic
1131401999 15:92132756-92132778 ACTTGGCATTTCACTGAAACAGG - Intronic
1132311339 15:100860217-100860239 ACTTTGAAATTGAGTAAGACTGG + Intergenic
1133145910 16:3786489-3786511 ATTTGGAAATTCAGTGAAAACGG + Intronic
1133538876 16:6729049-6729071 ACTGGGAATATGTGAGAAACAGG - Intronic
1137290039 16:47046288-47046310 TCTTGAAATTTAAATGAAACTGG - Intergenic
1139233152 16:65306712-65306734 ACTTGGACTTTGTGTGAGAAAGG + Intergenic
1140227872 16:73093248-73093270 ACGTGGCCTTTGAGTGAACCTGG - Intergenic
1141254500 16:82388126-82388148 ACATGGAAATTTAATGAAACAGG + Intergenic
1144971157 17:19110812-19110834 ACAAGGTTTTTGAGTGAAACCGG + Intergenic
1144991459 17:19236975-19236997 ACAAGGTTTTTGAGTGAAACCGG + Intronic
1146050269 17:29545176-29545198 ACTTGTAATATCAGTGAAAGGGG + Exonic
1147298294 17:39502685-39502707 ACTTTGAATTTGAGAGTATCTGG + Intronic
1149163488 17:53723226-53723248 ATTAGGAATGAGAGTGAAACTGG - Intergenic
1149285688 17:55161655-55161677 ACTAGGTATTTGACAGAAACAGG - Exonic
1150121958 17:62611186-62611208 ACAAGGAATTGGAGTTAAACAGG - Intronic
1152056510 17:78032170-78032192 ACTAGGAAATTGAGAGAAAAGGG - Intronic
1153322346 18:3785623-3785645 ATTTGGATTTTGAATGAACCTGG + Intronic
1156701706 18:39834032-39834054 AATTGGAGCTTGAGTGAAAATGG - Intergenic
1156751488 18:40462642-40462664 ACATGAAATTTGAGGGATACAGG + Intergenic
1157970376 18:52260682-52260704 ATTAGGAATTTGAGTGTCACAGG + Intergenic
1158226987 18:55211474-55211496 ACTTTGAATCTGAAAGAAACTGG + Intergenic
1158416575 18:57254094-57254116 GCTTGGAATTCAAGGGAAACAGG - Intergenic
1159110954 18:64055998-64056020 ACTTGAAATTTGAATAAATCTGG - Intergenic
1161876009 19:6910305-6910327 ACTTGAAATTTGGGTGGAGCGGG - Intronic
1164116094 19:22220301-22220323 TCTTGGTATTAGAGTGATACTGG + Intergenic
1164700826 19:30282749-30282771 CCTTAGATTTTGAGTGACACGGG + Intronic
1166614424 19:44230381-44230403 ACAAGGACTTTGAGTGAAATGGG - Intronic
1167646300 19:50707156-50707178 AAATGGAATTTCAGTGAGACGGG - Intronic
927318287 2:21711588-21711610 ACGTGGAATGTGAGGGAAAGAGG + Intergenic
928066227 2:28166963-28166985 ACTTGGAAATAGATTGAGACTGG + Intronic
928081444 2:28316063-28316085 ATTTGAAATTTAAGTGTAACTGG - Intronic
929436120 2:41929783-41929805 ACCTGAAATTTGAATGTAACTGG + Intergenic
930271622 2:49264012-49264034 AGTTGTAATTTGGGTGAAGCTGG + Intergenic
931235353 2:60407997-60408019 ACTTGGCATTTGAATTAGACAGG + Intergenic
931492416 2:62762885-62762907 ACTTATATTTTGAGTGAAATGGG - Intronic
935407627 2:102725601-102725623 ACTTGGATTTTGTGTGGTACTGG + Intronic
936492254 2:112982404-112982426 CCTTGCAATCTGAGTGAAATGGG + Intronic
936774494 2:115956494-115956516 ACTTGGTATTTGAAGCAAACTGG - Intergenic
939451528 2:142380608-142380630 ACTTGGAAAAGGAGAGAAACTGG + Intergenic
940390779 2:153130308-153130330 ACTCTGACTTTGAGTGAAATGGG - Intergenic
940681489 2:156791080-156791102 ACTTGGAATTTAAGAAAGACAGG + Intergenic
942004730 2:171686678-171686700 ACTTGGAATTTGAATCATAAAGG + Intergenic
943137315 2:183930017-183930039 ACGTGGAATTTGAAGGACACAGG - Intergenic
943781995 2:191835250-191835272 ATTTGGAAAATGAGAGAAACAGG - Exonic
944276610 2:197845993-197846015 ACTAGGAAATTTAGTGAAATGGG + Intronic
945100792 2:206260700-206260722 ACTTGGAATCTTAATGAAAAAGG + Intergenic
946753623 2:222919816-222919838 ACCTGGAATTTGAGTGGTAGTGG + Intronic
947156361 2:227165448-227165470 ACTTGGAATTTGAGTGAAACTGG + Intronic
947636368 2:231682565-231682587 ACGTTGAATTTGAGAAAAACTGG - Intergenic
1170614264 20:17936419-17936441 ACTGGGGCTTTGAGTCAAACAGG + Intergenic
1170995654 20:21354731-21354753 AGTTGGAATTTGGGTGATCCTGG + Intronic
1172716680 20:36969447-36969469 ACTTGGCCTTGGAGTGTAACAGG + Intergenic
1179626309 21:42651420-42651442 AGTTGGAATTTTAGAGAAAGTGG - Intergenic
1180740279 22:18048777-18048799 ACTTGGAATAGGAGGGGAACAGG - Intergenic
1181718426 22:24753297-24753319 AGTTGGTTTTTGAGTTAAACTGG + Intronic
1182101979 22:27663842-27663864 ACCTACAATTTGAGTCAAACAGG - Intergenic
1183316171 22:37137950-37137972 ACTGGGAATAAAAGTGAAACAGG - Intronic
949618453 3:5782976-5782998 ACTTGAAAATTGCTTGAAACAGG - Intergenic
951303175 3:21023552-21023574 GCTTGGAAGGTGTGTGAAACTGG - Intergenic
952367799 3:32690230-32690252 ACTTGGTATTTGTGGGAAATTGG + Intronic
952899523 3:38100224-38100246 ACTTGGAATTGCAGAGGAACTGG - Intronic
953000377 3:38927104-38927126 ATTTAGAATTTCAGAGAAACAGG + Intronic
953287695 3:41628679-41628701 ATTTGGAAAATGGGTGAAACTGG + Intronic
953789346 3:45935360-45935382 ACTTTGAATCTGAGGGAAATGGG - Intronic
954817444 3:53293983-53294005 ACTAGGAAGAGGAGTGAAACTGG + Intronic
955009996 3:55004554-55004576 ACTTGGAATTTGAAGGACAAAGG - Intronic
955798526 3:62662534-62662556 ACTTGGAATTTCACTCAGACTGG - Intronic
957825665 3:85439457-85439479 ACTTGATTTTTGACTGAAACTGG + Intronic
958803815 3:98785675-98785697 ACTTGGATTTTAAGTGCAACAGG + Intronic
959382294 3:105655685-105655707 ACCTGGAATTTTAGTGATTCTGG - Exonic
960250020 3:115441420-115441442 ACTTGTAGTTTGAGTGATAAAGG - Intergenic
960865434 3:122194773-122194795 ACGTGGATGTTGGGTGAAACTGG - Intronic
962320442 3:134385634-134385656 ACTTAGAATTTGAATGAGAAAGG - Intergenic
962565973 3:136660620-136660642 ACTTAGAATGTGTATGAAACAGG - Intronic
964683901 3:159373561-159373583 GCTGGGAATTTGAGGGAAATAGG - Intronic
964951147 3:162295163-162295185 ACCAGGCATTTGAGCGAAACTGG - Intergenic
965144166 3:164877517-164877539 ATTTGTAATTTGATTAAAACTGG - Intergenic
966709864 3:182960241-182960263 AATTGGAATTTGTGGGAAATGGG - Intronic
971756402 4:30713947-30713969 GCTTGGAATTTGAGTAACATAGG - Intergenic
972923955 4:43980370-43980392 ACTTGGAAAGTAAATGAAACTGG - Intergenic
973185239 4:47319671-47319693 CTTTGGAATTAGAGTGAAGCTGG + Intronic
974971670 4:68837148-68837170 AGTTGGAATTTCTGTGAAATGGG - Intergenic
976125269 4:81827701-81827723 ACTTGGAATGAGTGTGAAAGAGG + Intronic
977555218 4:98481323-98481345 CCTTGCATTCTGAGTGAAACGGG + Intronic
978326285 4:107560897-107560919 GTCTGGAATGTGAGTGAAACTGG - Intergenic
978504600 4:109443096-109443118 ACTGAGAATTTGAGGGAAAAGGG - Intronic
978742802 4:112156698-112156720 ACTTGGACTTTGTGTATAACAGG + Intronic
979216548 4:118171319-118171341 ACTCCCAATTTGAGTGTAACTGG - Intronic
979308213 4:119173209-119173231 ACTGTGAATCTGAATGAAACAGG + Intronic
979957132 4:126968086-126968108 ACATGGAACGTGAGTGAGACGGG - Intergenic
981798003 4:148620163-148620185 ACTTGGACTTGGAGTCAGACTGG + Intergenic
982105952 4:152012231-152012253 ACTTGACATTTAAGTGAAATGGG + Intergenic
983370156 4:166848298-166848320 ACTTTGAATTTGAGGAAAAGGGG + Intronic
984261038 4:177443856-177443878 ACTGGAAACTTGGGTGAAACAGG + Intergenic
985147516 4:186908042-186908064 ATTTGTAATTTCAGTGAAGCAGG + Intergenic
985900462 5:2785244-2785266 ACAAGAATTTTGAGTGAAACAGG + Intergenic
986954152 5:13129859-13129881 ACCTGGAATTTGAGTGCAAAGGG + Intergenic
988631797 5:32939545-32939567 ACTTGGAATTTTGGTGAAAGAGG - Intergenic
988975750 5:36514445-36514467 GCTTTGACTGTGAGTGAAACCGG + Intergenic
989765076 5:45073393-45073415 ACTTGGTGAATGAGTGAAACTGG - Intergenic
990743363 5:58934744-58934766 AGCTGGAGTTTGAGAGAAACTGG + Intergenic
990951486 5:61302865-61302887 GCTTGGAGTTTGAGTGTAAATGG - Intergenic
991236457 5:64405099-64405121 ACTTGTATTTTCAGTGAAAATGG + Intergenic
994077754 5:95672190-95672212 AACTGCAATTTCAGTGAAACTGG + Intronic
994414014 5:99444680-99444702 ACTTGAATTTTGATTGAAAAAGG + Intergenic
995297226 5:110536330-110536352 CCTTGGTATTTGAGGGCAACTGG + Intronic
996335200 5:122376722-122376744 ACCAGGAACTTGAGTGAAATTGG - Intronic
996967190 5:129320506-129320528 ACATGGGATTTGAGAGAAGCCGG - Intergenic
996982969 5:129522559-129522581 ACATGATATTTGAGTAAAACTGG + Intronic
999399086 5:151250584-151250606 CCTTGGTAATTGAGGGAAACTGG - Intronic
1001166107 5:169369470-169369492 CTTTGGTATTAGAGTGAAACAGG - Intergenic
1003287637 6:4748492-4748514 ACTTGGAATAGGAGCAAAACAGG + Intronic
1004152079 6:13130812-13130834 TTTTGGAATTAGAGTGATACTGG - Intronic
1005664043 6:28031441-28031463 ACTTGGATTAAGAGTCAAACAGG + Intergenic
1007837821 6:44688842-44688864 TTTTGGAATTAGAGTGATACTGG + Intergenic
1008519843 6:52352496-52352518 ACTGGTAGGTTGAGTGAAACAGG + Intergenic
1012741314 6:103019425-103019447 ACTTGGAGTTTCAATAAAACAGG + Intergenic
1013807376 6:114010821-114010843 GCTTGGAAATTGAGGGCAACTGG - Intronic
1013914341 6:115316813-115316835 AATTGAAATTTGATTGAAATTGG + Intergenic
1014427318 6:121324190-121324212 AGTTGTAAATTGAGTGAAAAGGG + Intronic
1016449007 6:144161833-144161855 ATTTGGAATTTGAATGTAAGGGG + Intronic
1021428692 7:20534646-20534668 GCTTGGAATTTAATTGCAACTGG + Intergenic
1021687769 7:23204059-23204081 ACTTGGAAGTTGAGTGACTTTGG - Intergenic
1021908744 7:25363101-25363123 ACATGGAATTTGGGGGAAAAAGG + Intergenic
1022458298 7:30578924-30578946 TCTTGGTAATTGAGGGAAACTGG - Intergenic
1028724021 7:94066859-94066881 ACTTATAATTTGAGGGAAAGAGG - Intergenic
1034332311 7:150293558-150293580 AATTGGAATTTGAGGGACAGGGG - Intronic
1034586172 7:152094397-152094419 ACTTGGGCCTCGAGTGAAACGGG - Exonic
1034665724 7:152816320-152816342 AATTGGAATTTGAGGGACAGGGG + Intronic
1036533304 8:9618724-9618746 ATTTGGAAATTGAGAGAAACAGG + Intronic
1036842403 8:12134317-12134339 ACATGTAATATGAGTGTAACCGG + Intergenic
1036863683 8:12375854-12375876 ACATGTAATATGAGTGTAACCGG + Intergenic
1037552470 8:19988213-19988235 GCTTGGAATATGAGGGAAAGAGG + Intergenic
1038831345 8:31064568-31064590 ACAAGGAATGTGAGTGAATCAGG - Intronic
1038960158 8:32509546-32509568 AATTGGAATTTGAGGGATGCAGG + Intronic
1041964536 8:63659706-63659728 ATTTGGAATTTGCTTGAAAATGG + Intergenic
1042646315 8:70990625-70990647 ACTTGCAATTTGGGTTAAAATGG - Intergenic
1042691675 8:71506360-71506382 ACTTGCAAATTGAGCTAAACAGG + Intronic
1044561737 8:93618835-93618857 AGTTCTAGTTTGAGTGAAACTGG + Intergenic
1044857475 8:96491581-96491603 AATTGGAATTCCAGTAAAACAGG - Intergenic
1044860821 8:96521925-96521947 ACTTGGAATTTTAGTGAATTAGG - Intronic
1047350929 8:124072858-124072880 ACTTGGGTTTTGGGAGAAACAGG + Intronic
1050772765 9:9223677-9223699 ACTTGGTACTTGAGAAAAACAGG + Intronic
1052360707 9:27553505-27553527 CATAGGAATTGGAGTGAAACTGG + Intronic
1055494321 9:76839604-76839626 GCTTGGATTTTGAGTGAGACAGG + Intronic
1055901544 9:81244833-81244855 AGTAGAAATTTGTGTGAAACTGG - Intergenic
1058924081 9:109644339-109644361 ACTTTGAATATGAGTGAAATAGG + Intronic
1059208663 9:112489696-112489718 AATTTGAATTTGTGTAAAACTGG + Intronic
1059827162 9:118044063-118044085 ACTTAGAAATTGACTGAAAATGG - Intergenic
1059980906 9:119770756-119770778 AGTTGGAAAAAGAGTGAAACAGG - Intergenic
1185933148 X:4225422-4225444 TCCTGGAATTTGAGTAAGACTGG + Intergenic
1186016061 X:5195535-5195557 ACATGGAATTGGAATGAAAATGG - Intergenic
1187707962 X:22025927-22025949 ACTTGGAATTTGCTTTAATCTGG - Intergenic
1188012754 X:25075071-25075093 ACTTGGAGAGTGAGAGAAACAGG - Intergenic
1189911132 X:45811470-45811492 GCCTGGTATTTCAGTGAAACAGG - Intergenic
1192545432 X:72008947-72008969 ACTTTGAATCTGAGTGAGATGGG - Intergenic
1193425028 X:81331874-81331896 ACTTAGAAATGGAGTGAAAAGGG - Intergenic
1194351720 X:92829693-92829715 CCTTGGAAATTGAGGGCAACTGG - Intergenic
1195410402 X:104564127-104564149 ACTGGGTATTAGAGTGAAATTGG + Intergenic
1195886459 X:109644178-109644200 ACTTCTAATTTCAGTGAAATTGG - Exonic
1199726191 X:150584694-150584716 CCTTGGTATTTGCGGGAAACTGG + Intronic
1200660035 Y:5946384-5946406 CCTTGGAAATTGAGGGCAACTGG - Intergenic
1201646896 Y:16243604-16243626 ACATGGAATTGGAATGAAACTGG - Intergenic
1201655915 Y:16341698-16341720 ACATGGAATTGGAATGAAACTGG + Intergenic