ID: 947156535

View in Genome Browser
Species Human (GRCh38)
Location 2:227167429-227167451
Sequence CCAGCTCACCCACTTGAAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 143}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947156526_947156535 12 Left 947156526 2:227167394-227167416 CCCAGCGCATCCCCAGGTTTTAT 0: 1
1: 0
2: 0
3: 7
4: 124
Right 947156535 2:227167429-227167451 CCAGCTCACCCACTTGAAATAGG 0: 1
1: 0
2: 0
3: 12
4: 143
947156523_947156535 30 Left 947156523 2:227167376-227167398 CCAGTTCCAGGCTGGCTGCCCAG 0: 1
1: 0
2: 4
3: 39
4: 354
Right 947156535 2:227167429-227167451 CCAGCTCACCCACTTGAAATAGG 0: 1
1: 0
2: 0
3: 12
4: 143
947156532_947156535 0 Left 947156532 2:227167406-227167428 CCAGGTTTTATAGCTGTCAGGGC 0: 1
1: 0
2: 0
3: 13
4: 88
Right 947156535 2:227167429-227167451 CCAGCTCACCCACTTGAAATAGG 0: 1
1: 0
2: 0
3: 12
4: 143
947156527_947156535 11 Left 947156527 2:227167395-227167417 CCAGCGCATCCCCAGGTTTTATA 0: 1
1: 0
2: 1
3: 6
4: 75
Right 947156535 2:227167429-227167451 CCAGCTCACCCACTTGAAATAGG 0: 1
1: 0
2: 0
3: 12
4: 143
947156528_947156535 2 Left 947156528 2:227167404-227167426 CCCCAGGTTTTATAGCTGTCAGG 0: 1
1: 0
2: 2
3: 9
4: 119
Right 947156535 2:227167429-227167451 CCAGCTCACCCACTTGAAATAGG 0: 1
1: 0
2: 0
3: 12
4: 143
947156530_947156535 1 Left 947156530 2:227167405-227167427 CCCAGGTTTTATAGCTGTCAGGG 0: 1
1: 0
2: 0
3: 14
4: 125
Right 947156535 2:227167429-227167451 CCAGCTCACCCACTTGAAATAGG 0: 1
1: 0
2: 0
3: 12
4: 143
947156524_947156535 24 Left 947156524 2:227167382-227167404 CCAGGCTGGCTGCCCAGCGCATC 0: 1
1: 0
2: 2
3: 15
4: 225
Right 947156535 2:227167429-227167451 CCAGCTCACCCACTTGAAATAGG 0: 1
1: 0
2: 0
3: 12
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947156535 Original CRISPR CCAGCTCACCCACTTGAAAT AGG Intronic
900577607 1:3391213-3391235 ACAGTTTACCCCCTTGAAATGGG + Intronic
903460423 1:23516823-23516845 CAAGCTCACCCACTGGCATTGGG - Intronic
904595337 1:31640999-31641021 CCAGCAGAGCCACTTGAAATAGG + Intronic
905429034 1:37908305-37908327 ACATCTCACCAACTTCAAATTGG + Intronic
906941508 1:50259814-50259836 CGAGCTGACCCAGTTGCAATGGG - Intergenic
908004721 1:59716092-59716114 CCAGCTAACCTACTTAAAATAGG - Intronic
912734191 1:112135498-112135520 CCAGCTAACCCTCTGGATATGGG + Intergenic
915400340 1:155617310-155617332 GCAGATCACTCACCTGAAATAGG + Intergenic
916012602 1:160719519-160719541 CAAGCTCAGCCACTGGAAAAAGG + Intergenic
916356563 1:163916746-163916768 CCACCCCACCCACATGCAATTGG - Intergenic
917860867 1:179142066-179142088 CCAGCCCACACACTTGCATTTGG - Intronic
922241244 1:223756669-223756691 CCTGCTCACCCACCTGAGAAAGG + Intronic
924261793 1:242238951-242238973 CCAGGTATCCCACTTGAACTGGG - Intronic
1063106637 10:2997931-2997953 ACAGCTCACCGATTTTAAATCGG - Intergenic
1064246823 10:13674877-13674899 CTAGCTCATCCCGTTGAAATTGG - Intronic
1064553265 10:16522821-16522843 GCAGCTCACCCACTGAGAATGGG - Intergenic
1067789640 10:49278087-49278109 CCAGTTCACCCACATGGACTTGG + Intergenic
1067828815 10:49598193-49598215 CCACCTCACCCACTGTGAATGGG - Intergenic
1069070756 10:63988491-63988513 CAAGCTCAGCCACTGGAAAAAGG + Intergenic
1069368203 10:67715612-67715634 CCAGATGAACCACCTGAAATAGG - Intergenic
1069491276 10:68863104-68863126 CCATCTCACCCACATGAAGAAGG - Intronic
1069906865 10:71737131-71737153 CCAGTCCGCCCATTTGAAATGGG - Intronic
1074826913 10:117221250-117221272 CCAGCTCCACCACCTGAAACTGG - Intergenic
1076132977 10:128026443-128026465 CGAGCTGACCCACTGGAAGTGGG - Intronic
1076434004 10:130427208-130427230 CCAGGTCACTCACTTCAGATAGG + Intergenic
1078376643 11:10800206-10800228 CTAGCTCAACCACTAGAAAGTGG - Exonic
1079080212 11:17408638-17408660 CCAGCTCATCCACTGCAAGTGGG + Intronic
1088598767 11:111457841-111457863 CCAGCTCAGCTACTTGTACTGGG + Intronic
1089401135 11:118165304-118165326 CCAAGTCACTCACTTAAAATGGG - Exonic
1089684612 11:120138795-120138817 CCAGCTCGGCCACTTGACTTAGG - Intronic
1089827452 11:121291968-121291990 CCAGCTCAGCAACTTCAAAGTGG - Intergenic
1090668236 11:128929445-128929467 CCACCTCTCCCCCTTTAAATCGG + Intergenic
1092501310 12:9050749-9050771 CCACCTCGCCAACTTGAAAGGGG - Intergenic
1093310545 12:17577108-17577130 CCAGATCAACCAAATGAAATTGG + Intergenic
1097493368 12:60297321-60297343 CAAGCTCAACCACTGGAAATGGG + Intergenic
1105618933 13:22048285-22048307 GCATCTCACAGACTTGAAATGGG + Intergenic
1108464552 13:50701813-50701835 CCTGCTCCACCACTTGAAATTGG - Intronic
1112133376 13:96548821-96548843 TCAGCTCACCCACGTGAGAGAGG + Intronic
1113647613 13:112010256-112010278 CCATGTCACACACTGGAAATTGG + Intergenic
1114221461 14:20701375-20701397 ACATCTCACCCATTTCAAATTGG + Intergenic
1114836203 14:26205273-26205295 AAAGCTCACACACTTCAAATTGG - Intergenic
1118038541 14:61893463-61893485 CCAGGTCACCCCCTAGAAAATGG - Intergenic
1121661629 14:95639561-95639583 CCATGTCTCCCACTTGAAATGGG - Intergenic
1121721866 14:96115004-96115026 CAAGCTCATCCACTAGAAATGGG - Intergenic
1123429393 15:20202097-20202119 CCAGCTCACCCCCTGTAGATTGG + Intergenic
1126069503 15:44853356-44853378 CCACCTCTCCACCTTGAAATGGG - Intergenic
1127715152 15:61642712-61642734 AAAGCTCACCTACTTGAAAAAGG - Intergenic
1128927748 15:71674261-71674283 CCAGCTCTGCCCATTGAAATTGG + Intronic
1129747140 15:78030595-78030617 CCACCTCACCCAATCGAAATGGG + Intronic
1130933238 15:88447751-88447773 CCAGCTCAGCCACTAGACAAAGG - Intergenic
1136777173 16:32878259-32878281 CAAGCTCACACAATTGATATTGG + Intergenic
1136854929 16:33647632-33647654 CCAGCTCACCCCCTGTAGATTGG - Intergenic
1136893449 16:33983254-33983276 CAAGCTCACACAATTGATATTGG - Intergenic
1137479743 16:48842258-48842280 CCAGCTCAGACTCATGAAATTGG - Intergenic
1139699039 16:68695885-68695907 CCAGCCAACCCAGATGAAATCGG + Exonic
1140094919 16:71866941-71866963 CCACCTCATCCATTTGATATTGG - Intronic
1203079587 16_KI270728v1_random:1140368-1140390 CAAGCTCACACAATTGATATTGG + Intergenic
1203116506 16_KI270728v1_random:1496117-1496139 CCAGCTCACCCCCTGTAGATTGG - Intergenic
1143107183 17:4535705-4535727 CCAGCACACCCCTCTGAAATTGG - Intronic
1143868986 17:9944453-9944475 CCGGACCACCCCCTTGAAATAGG + Intronic
1146543374 17:33717488-33717510 CCATCGCTCCCACTTTAAATAGG - Intronic
1147157779 17:38552900-38552922 CCAGCCCAGCCCCCTGAAATTGG + Intronic
1148623209 17:49050152-49050174 CCAGATCACCATCTTCAAATTGG + Exonic
1148969467 17:51467052-51467074 CCACCACACCCAGCTGAAATAGG - Intergenic
1149429630 17:56587359-56587381 TCATCCCACCCACCTGAAATGGG + Intergenic
1149627057 17:58087209-58087231 CCAGCACACCTTCTTGATATAGG - Exonic
1152263364 17:79279061-79279083 CCAGCTCTGCCACTAGTAATTGG - Intronic
1153980005 18:10300711-10300733 GCAGCTCCCCCAGTTGGAATAGG + Intergenic
1154055615 18:11010641-11010663 AAAACTCACCAACTTGAAATGGG + Intronic
1154343874 18:13526739-13526761 CCAGCTCACCCACATATAAATGG - Intronic
1155463849 18:26114148-26114170 CCAATTCTCCCATTTGAAATGGG + Intergenic
1158703305 18:59768911-59768933 CCATGACACCCACTTGAAACTGG - Intergenic
1159767038 18:72503047-72503069 CCACCTCACCAACTTGGAAGAGG + Intergenic
1161752045 19:6105286-6105308 CCAGGCCACCCACTTGAGAATGG - Intronic
1166656355 19:44614860-44614882 CCAGGTCACACACTTGGAAGTGG + Intronic
925737920 2:6980419-6980441 CAAGTTCTCCCATTTGAAATGGG - Intronic
926192741 2:10740972-10740994 CCACCACACCCAGCTGAAATTGG + Intronic
926734538 2:16062953-16062975 CAATTTCTCCCACTTGAAATGGG - Intergenic
926775395 2:16417361-16417383 CCAGTTCACACACTCTAAATTGG - Intergenic
931321672 2:61178697-61178719 CTAGCTCGCCCACTGGAAATAGG - Exonic
931759691 2:65405932-65405954 CAAGCTGACCCTCTTGCAATGGG + Intronic
933836594 2:86250872-86250894 CCAGCTCAGTCTCTTGAAACTGG + Intronic
934112053 2:88753156-88753178 TCAGGTCACCCACTGGAAAGTGG + Intergenic
936710049 2:115121557-115121579 CAAGCTCAGCCACTGGAAAAAGG - Intronic
938730022 2:134140174-134140196 TCAGCTCTCCCCCTGGAAATAGG + Intronic
938815378 2:134898367-134898389 CCAGCTCACCTAGTGGAAAGGGG - Exonic
944170640 2:196773043-196773065 GCAACTCAGCCTCTTGAAATCGG + Exonic
946742198 2:222813833-222813855 CCAGCTCACTGCCTTGACATTGG + Intergenic
947156535 2:227167429-227167451 CCAGCTCACCCACTTGAAATAGG + Intronic
1169202673 20:3720416-3720438 CAAGCCCACCCACTGAAAATGGG + Intergenic
1169429933 20:5527544-5527566 GCAACTCACCTAATTGAAATAGG + Intergenic
1170065200 20:12303293-12303315 CAATTTCCCCCACTTGAAATGGG - Intergenic
1174340224 20:49890811-49890833 CCAGCTCACCCACTGTGAAGAGG - Exonic
1175600099 20:60266261-60266283 CCACTTTACCCACTTGCAATGGG + Intergenic
1181926283 22:26361637-26361659 CAAGCTCACGCACATGAGATGGG - Intronic
1183067021 22:35370330-35370352 CAAGCTCAGCCACTGGAAACGGG + Intergenic
951524385 3:23639941-23639963 CCAGCTCACTCACTAGTAGTAGG - Intergenic
953093480 3:39752464-39752486 CCAGCTCACCAACTTGACTGTGG + Intergenic
953573236 3:44089806-44089828 CAAGTTCATCCACTTGAAAGTGG - Intergenic
954939604 3:54359440-54359462 CCAGCTCACTCACTTGAGCTGGG - Intronic
956002415 3:64743303-64743325 AAACCTCACCCACTTGGAATAGG + Intergenic
957921002 3:86748392-86748414 CCAGTTCTCCCATTTGGAATGGG + Intergenic
958719665 3:97828161-97828183 CCAGCTTCCCCACATGAAACTGG - Intronic
972408212 4:38766371-38766393 CCAGGCCACCCACCTCAAATGGG + Intergenic
974013097 4:56625079-56625101 CCAGGTCACCCACAAGAGATGGG - Intergenic
983872935 4:172843042-172843064 CAAGCTCACCCTCTGGGAATGGG + Intronic
984543016 4:181064647-181064669 TCAAATCACCCACTTCAAATTGG + Intergenic
988080100 5:26403598-26403620 GCAGCTCACGAACTTGAAAAAGG - Intergenic
990137277 5:52661344-52661366 CTAGATCACCTTCTTGAAATTGG - Intergenic
991046928 5:62232533-62232555 CCAGCTCACCCCCTGTAGATTGG + Intergenic
992108235 5:73468314-73468336 CCAGGTCTCCAACTTGCAATTGG - Intergenic
992486215 5:77198982-77199004 CCCACACACCCACTTCAAATAGG + Intergenic
992486296 5:77200096-77200118 CCCACACACCCACTTCAAATAGG - Intergenic
994188501 5:96841472-96841494 CCATCTCAGCAGCTTGAAATTGG - Intronic
996791017 5:127292907-127292929 CTAGGTCACACACTTGAAATGGG - Intronic
997157025 5:131572284-131572306 CCATCTCACCAATTTCAAATCGG + Intronic
1001331774 5:170767308-170767330 ACAGCTCACCAATTTTAAATAGG - Intronic
1001434354 5:171687603-171687625 CCTGCTCACCCTCGTGAATTGGG - Intergenic
1001525132 5:172423519-172423541 TCAGCTCACCCACTTGGATACGG + Intronic
1004014905 6:11723349-11723371 GAAGCTCAACCACTGGAAATGGG - Exonic
1005575192 6:27183667-27183689 CCATCTCACCCACTGGAGAGAGG + Intergenic
1009388585 6:63117078-63117100 CTAGAACACCCACTAGAAATCGG - Intergenic
1010061318 6:71625964-71625986 CAATTTCTCCCACTTGAAATGGG + Intergenic
1013396718 6:109748165-109748187 CATGATCACCAACTTGAAATTGG - Intronic
1018584662 6:165344018-165344040 CCAGCTCACACACTTGCACGGGG - Intronic
1022764034 7:33389969-33389991 CCAGCACACACACACGAAATTGG - Intronic
1023018034 7:35985302-35985324 CCAGCTCTCCCACCTGATAGGGG - Intergenic
1029255097 7:99264295-99264317 CCTGCTCACCCTGTAGAAATTGG - Intergenic
1032870546 7:135979863-135979885 CCAGACCACCCACTTTAAATAGG + Intergenic
1034273254 7:149813323-149813345 CCAGGTCACCCGCTGGAATTGGG + Intergenic
1034383370 7:150718469-150718491 CCAGGTCAGCCACTTGAAGGTGG + Intronic
1035749921 8:1990113-1990135 ACAGCTCACACACTTGAGACAGG - Intronic
1040597567 8:48854415-48854437 CCACCACACCCAGTTGAATTTGG - Intergenic
1040645091 8:49388478-49388500 CAATTTCTCCCACTTGAAATGGG + Intergenic
1041509535 8:58640141-58640163 CCACATCATACACTTGAAATTGG + Intronic
1046387279 8:113520780-113520802 CAAGCTCAACCACTGGAAACAGG + Intergenic
1046391270 8:113575837-113575859 CCAGCTCACACACAGCAAATGGG + Intergenic
1047083408 8:121490395-121490417 CCATCTCACCCAATTTAAAATGG + Intergenic
1050363134 9:4850240-4850262 CCAGCTCACCAACCTCAGATGGG - Intronic
1052969347 9:34367525-34367547 CAACTTCTCCCACTTGAAATGGG - Exonic
1053338006 9:37295174-37295196 CCAATTCATCCACTTGGAATTGG - Intronic
1058862545 9:109130024-109130046 CCAACTGATACACTTGAAATGGG + Intergenic
1059886619 9:118751451-118751473 CCAGCTCAGCCACGTAGAATAGG + Intergenic
1062147843 9:134999935-134999957 CAAGCTCGGCCACTGGAAATGGG + Intergenic
1062553279 9:137100233-137100255 CCAGCACATCCACTTTGAATTGG + Intronic
1188863358 X:35285205-35285227 CAATTTCTCCCACTTGAAATGGG - Intergenic
1190931199 X:54950847-54950869 TCAGCTCCCCCACTGGAGATGGG - Intronic
1191130728 X:57007000-57007022 CCATCTAATCCACTTAAAATGGG - Intergenic
1192179459 X:68907312-68907334 CCATCTCACCATCTTGCAATGGG - Intergenic
1193331043 X:80236306-80236328 CAAGCTCAGCCACTGGAAATGGG - Intergenic
1193508506 X:82371790-82371812 CCAGCTCAACCACATGTACTTGG + Intergenic
1193686312 X:84580654-84580676 CAATTTCTCCCACTTGAAATGGG + Intergenic
1194359247 X:92928314-92928336 CCGGCTCACCAACAAGAAATGGG + Intergenic
1194929484 X:99868391-99868413 CCAGCTCACCCCATGCAAATTGG - Intergenic
1197672622 X:129295275-129295297 CCATCTCACCCACATTAAAATGG + Intergenic
1198242777 X:134801531-134801553 CAAGCTCGGCCACTGGAAATGGG - Intronic