ID: 947163135

View in Genome Browser
Species Human (GRCh38)
Location 2:227234678-227234700
Sequence ATCTAACTGCAGAGGCTCAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 121}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947163132_947163135 17 Left 947163132 2:227234638-227234660 CCTGGGACAAACAGTCATCAGAA 0: 1
1: 0
2: 3
3: 18
4: 202
Right 947163135 2:227234678-227234700 ATCTAACTGCAGAGGCTCAATGG 0: 1
1: 0
2: 1
3: 8
4: 121
947163131_947163135 25 Left 947163131 2:227234630-227234652 CCTTCTCTCCTGGGACAAACAGT 0: 1
1: 0
2: 0
3: 24
4: 244
Right 947163135 2:227234678-227234700 ATCTAACTGCAGAGGCTCAATGG 0: 1
1: 0
2: 1
3: 8
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947163135 Original CRISPR ATCTAACTGCAGAGGCTCAA TGG Intronic
902039884 1:13484937-13484959 GTCTAACTGCATAGGCACTAGGG - Intronic
902240098 1:15082667-15082689 AACAAACTGCAGAGGCTTAGAGG - Intronic
906225977 1:44121543-44121565 TTCTAATTTCAGAGACTCAAGGG - Intronic
907421412 1:54349930-54349952 AGCCAACAGCAGAGGCTAAAGGG - Intronic
910225806 1:84934877-84934899 ATCTGATTTCAGGGGCTCAATGG - Intronic
911491387 1:98572118-98572140 ATCAATTGGCAGAGGCTCAAGGG + Intergenic
913387258 1:118272160-118272182 ATCTAGCTGCAGAGGGAGAAAGG + Intergenic
914946498 1:152071442-152071464 ATCCCACTGCTGAGGCTCAGAGG - Intergenic
915605308 1:156946782-156946804 ATCAAACTGAAGAGGCAGAATGG + Exonic
915706834 1:157851964-157851986 GTCTAACTGCATAGTCACAAGGG + Intronic
917932341 1:179831510-179831532 AACCAGCTGCAAAGGCTCAAGGG + Intergenic
921677606 1:217993649-217993671 AGCTCACTGCAGAGGATGAACGG - Intergenic
923954715 1:239003094-239003116 ATGGAACTGCAGGGGCTCACTGG - Intergenic
924173897 1:241369696-241369718 CTCTCTCTGCAGTGGCTCAACGG - Intergenic
924784735 1:247184446-247184468 CTGTCACTGCAGAGGCTCATTGG + Intergenic
1070688764 10:78509419-78509441 ATCTAGGTGCAGAGGAGCAAGGG - Intergenic
1075216306 10:120539237-120539259 CTCTAACAGCAGTGGCTCTAGGG - Intronic
1075234229 10:120711963-120711985 ACCTCACTGCAGAGTCTCAGGGG - Intergenic
1078766992 11:14307555-14307577 ATTTAACTGCTGAGCCTCAATGG - Intronic
1080958906 11:37134685-37134707 AACTACATGCACAGGCTCAAAGG + Intergenic
1083224251 11:61274579-61274601 ATCTCACTGCAGAGGAGAAAGGG + Exonic
1087649983 11:100854339-100854361 ATCTAACTGATGAGGTCCAATGG + Intronic
1087910953 11:103752836-103752858 CACTTACTGCAGAGGCTCTATGG - Intergenic
1089656508 11:119950810-119950832 ATCTCCCTGCAGTGGCTCACGGG - Intergenic
1092440755 12:8499845-8499867 ATTTAACTGCAGAGGAAGAAGGG - Intergenic
1092890850 12:12967978-12968000 ATGTATCTGCAAAGGCTCCACGG - Intergenic
1097896181 12:64825938-64825960 ATCGAGCTGCAGAGTCCCAAAGG + Intronic
1104553989 12:129783291-129783313 ATCTACCTTCAGAGGGTCAGAGG + Intronic
1105889257 13:24670382-24670404 ATCTAACTGCAGTGGTTAGAGGG - Intergenic
1108071638 13:46634943-46634965 ATCTAACTGGTAAGGGTCAAGGG - Intronic
1111344541 13:86933415-86933437 ATCTGACTGAAGTGTCTCAAAGG - Intergenic
1113389704 13:109883678-109883700 ATCAACATGCAGAGGCTTAAGGG - Intergenic
1114693859 14:24608804-24608826 ATCCAACTCCAGAAGCTCATGGG - Intronic
1120858053 14:89229971-89229993 CTCTCACTGCAGAGCTTCAAGGG - Intronic
1121643063 14:95499246-95499268 ATCTAACGGCTCAGGGTCAAAGG + Intergenic
1126121035 15:45251848-45251870 CTCCACCTCCAGAGGCTCAAGGG + Intergenic
1126944613 15:53805664-53805686 ATCTAACTGGAGAGCCTAATTGG + Intergenic
1131080555 15:89531074-89531096 ATCTAACTGCATCGTCTCTAAGG - Intergenic
1131706543 15:95002212-95002234 ACCTTTCTACAGAGGCTCAAGGG + Intergenic
1132612851 16:825894-825916 AAATAAAAGCAGAGGCTCAAAGG - Intergenic
1133617133 16:7487782-7487804 ATCTTACTGAAGAGGCTCTTAGG - Intronic
1135233360 16:20730546-20730568 GTGTCACTGCAGAGGCTCACTGG - Intronic
1139441565 16:66970525-66970547 ATCTGACAGCTGAGGCTCTAGGG - Intronic
1141592361 16:85077351-85077373 TGCTAACTGCAGAGGCCCAGAGG - Intronic
1146563276 17:33890140-33890162 AGCTAATTTCAGGGGCTCAATGG + Intronic
1147283211 17:39379694-39379716 CTCAAACTCCTGAGGCTCAAGGG - Intronic
1149297242 17:55272074-55272096 AGCTAACTGCAGGGGCTCCTCGG + Intronic
1151238000 17:72735541-72735563 AACTCAGTGCAGTGGCTCAAGGG - Intronic
1154031122 18:10755498-10755520 ATCTGACTGCAGAGGCACAGTGG + Intronic
1157060184 18:44279035-44279057 AGCTTATTGCAGAGTCTCAAAGG + Intergenic
1158700500 18:59741486-59741508 TTTTAACTTCAGAGTCTCAATGG - Intergenic
1159287198 18:66369839-66369861 ATCTAACTTGAGAGACTCACTGG - Intergenic
1159999933 18:75007990-75008012 ATTGAAATGCACAGGCTCAAGGG + Intronic
1162737003 19:12752291-12752313 AGCTGACTGCAGGGACTCAAGGG + Intronic
1163798028 19:19348443-19348465 CTCTAGCTGCAGAGGCACAGGGG - Intronic
1164415360 19:28042747-28042769 CTATAGCTGCAGAGGCTCATAGG - Intergenic
1166167916 19:41005354-41005376 ATGTAAATGCAGAGGCTGCATGG + Intronic
1167355804 19:49003318-49003340 CTCTACCTGCCGAGGCTCCAAGG - Exonic
1167635103 19:50649693-50649715 AAGGAACTGCAGAGGCTCATGGG - Intronic
925014748 2:514316-514338 ATCTAAGGACAGAGGCTCATTGG - Intergenic
928013216 2:27629847-27629869 ATATCTCTGCAGAGGCTCACAGG + Exonic
928751901 2:34480228-34480250 ATCGAACTGCAGGGTCTGAAGGG - Intergenic
932717113 2:74109147-74109169 ATCCATCTGCAGAGCCTGAAGGG + Intergenic
933190509 2:79328850-79328872 AGCTCCCTCCAGAGGCTCAAGGG + Intronic
935525738 2:104164165-104164187 ATAGAACTGCAGAGGGTGAAGGG - Intergenic
935525742 2:104164191-104164213 AGCTAACTGCAGAGTGTAAAGGG - Intergenic
937472087 2:122182887-122182909 ATCTGAGTGCAGTGGCACAAGGG - Intergenic
939602201 2:144206569-144206591 AGTTAACTGCAAAGGCTAAATGG + Intronic
940348097 2:152648423-152648445 ATGCAACTGCAGTGGCACAAAGG + Exonic
941184057 2:162299097-162299119 ACCTAAGTGCAAAGGCTAAAGGG - Intronic
947163135 2:227234678-227234700 ATCTAACTGCAGAGGCTCAATGG + Intronic
1175261417 20:57676629-57676651 GTCCAGCTGCAGAGGCTCAAGGG + Intronic
1180132957 21:45838775-45838797 ATCTGACTGCATATCCTCAAGGG - Intronic
1181349090 22:22242699-22242721 ATCTAACTCTAGATGCTCCAGGG + Intergenic
950541079 3:13613643-13613665 ATCTAACTGCAAAGGCCCCTGGG + Intronic
952968382 3:38635278-38635300 ATGGATCTGCAGAGGCTCACTGG + Intronic
955888290 3:63623535-63623557 ATAAAATAGCAGAGGCTCAAAGG - Intergenic
957982675 3:87530485-87530507 ATATAACTGCAGAATCTCAAGGG - Intergenic
961415300 3:126752543-126752565 ATCTAGCTGAGGAGGCTGAAAGG + Intronic
964326825 3:155555885-155555907 AAATAAGTGCAGCGGCTCAATGG + Intronic
968544761 4:1193237-1193259 ATGTCACTGCAGAGACTCAGTGG + Intronic
971399194 4:26259739-26259761 CTCTAACTGAAGAGGACCAATGG - Intronic
972179388 4:36444695-36444717 ATCTCAAGGCAGAGGCTCAATGG + Intergenic
975871809 4:78787460-78787482 GTCTAACGGTAGTGGCTCAAGGG - Intronic
976414384 4:84755395-84755417 ATCAAACTGCAGAGGTGAAAGGG + Exonic
979123924 4:116942427-116942449 ACCTAAATGCAGAGGTTTAAAGG - Intergenic
981522838 4:145681692-145681714 ATCTTATTGCAGAGGGTGAAAGG + Intronic
981739967 4:147991271-147991293 AACTAAATGCAGAGTCTCACGGG - Intronic
982392459 4:154880020-154880042 ATCTAACTGCAAAGATTAAAAGG - Intergenic
982465261 4:155722668-155722690 ATCTAACTTGAGAGGTTCATGGG - Intronic
986424820 5:7620869-7620891 AACTAACTGCACAGTGTCAAAGG - Intronic
987265273 5:16246853-16246875 AAATAATTGCAGAGGCTCATTGG - Intergenic
988243471 5:28645256-28645278 TTCAAAGTGCAGAGACTCAAAGG + Intergenic
989140965 5:38200934-38200956 AAGTAATGGCAGAGGCTCAAGGG + Intergenic
990802847 5:59624754-59624776 ATCATACTGCAAAGGCTTAAAGG - Intronic
991077765 5:62560681-62560703 CTCAAACTGCAGAGTTTCAAAGG - Intronic
992155909 5:73955017-73955039 ATCTACCTGCAGAGATTCAGGGG - Intergenic
992600545 5:78394567-78394589 ATCTAGCTGCAGGGGCTGACTGG + Intronic
995230262 5:109753432-109753454 ATCAAACTTCAGATTCTCAAAGG - Intronic
995749755 5:115441653-115441675 ATCTAACTGAAGCTGCTCACTGG + Intergenic
996671998 5:126128833-126128855 TTCTAAGTGCAGAGGGTTAAAGG + Intergenic
1005676495 6:28160879-28160901 AGCTCACTGCAAGGGCTCAAGGG - Intergenic
1005707571 6:28470523-28470545 ATCTAATTACAGTGGCTAAAAGG + Intergenic
1007976019 6:46102065-46102087 ATGAAACTTCAGGGGCTCAAGGG - Intergenic
1011868720 6:91865182-91865204 ATCTCACTGTAAAGGATCAAGGG + Intergenic
1012096010 6:94962042-94962064 ATTTCACTGCAGAGCCTCAAAGG - Intergenic
1016644854 6:146394844-146394866 ATCCATCTGGAGATGCTCAAAGG + Intronic
1021142456 7:17044472-17044494 ATAAAACTGGAGAGGCTCACTGG - Intergenic
1026400393 7:70005926-70005948 ATCCAACTGCAGAATTTCAAAGG - Intronic
1027787787 7:82602104-82602126 ATCTGAGTAGAGAGGCTCAAAGG + Intergenic
1031137702 7:117902914-117902936 ATTTCACTGCAGAGGCTGCAAGG - Intergenic
1032682324 7:134197625-134197647 ATTTAACTGCAGTTGCTCACTGG + Intronic
1034404149 7:150890984-150891006 ATTGAACTGCACAGGCTAAATGG + Intergenic
1036115288 8:5952735-5952757 ATCAAACTCCTGTGGCTCAAGGG + Intergenic
1037081522 8:14793360-14793382 ATCTTAGTGCAGTAGCTCAAGGG - Intronic
1037599623 8:20383020-20383042 CACCAAGTGCAGAGGCTCAAAGG - Intergenic
1039894366 8:41705920-41705942 TTCTCACTGCAGAGGCTCAAAGG + Intronic
1040823015 8:51585862-51585884 ATCTATCTGGAGAGCCACAAGGG - Intronic
1046623600 8:116554111-116554133 AACAAACTGCAGGGCCTCAAGGG + Intergenic
1047566453 8:126048987-126049009 TTCTAACTTCTGAGGCTCATGGG - Intergenic
1048215378 8:132489188-132489210 AGCTAACTGTAGAGACCCAAAGG + Intergenic
1048457756 8:134593208-134593230 ATCAAATAGCAGAGGCTCAGGGG - Intronic
1051372322 9:16369176-16369198 ATCTGACAGCAGAGGCGCATAGG - Intergenic
1052787997 9:32847718-32847740 ATGAAAATACAGAGGCTCAAAGG + Intergenic
1054922214 9:70554036-70554058 ACCTAACTGCAGTGGATAAATGG + Intronic
1057871972 9:98725268-98725290 ACCCAGCTGCAGAGGCTCAGAGG + Intergenic
1059331227 9:113536978-113537000 AGCTCAATGCAGAGGCTCAAGGG - Intronic
1186660751 X:11665461-11665483 TTCCGACTGCAGAGGCTCAAGGG + Exonic
1187311322 X:18146188-18146210 ATCTAACTGCAGGGGATCCTGGG - Intergenic
1197398091 X:125952568-125952590 ATTTCACTGAATAGGCTCAACGG - Intergenic
1200966287 Y:9041822-9041844 CTCTAACTGCTGAGGATCAGGGG + Intergenic