ID: 947163450

View in Genome Browser
Species Human (GRCh38)
Location 2:227237560-227237582
Sequence CTGCTGTCATAGTTAAAAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 166}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947163450_947163451 19 Left 947163450 2:227237560-227237582 CCACTTTTTAACTATGACAGCAG 0: 1
1: 0
2: 1
3: 19
4: 166
Right 947163451 2:227237602-227237624 TAGATATTATCCTGAAAAAAAGG 0: 1
1: 0
2: 1
3: 37
4: 389

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947163450 Original CRISPR CTGCTGTCATAGTTAAAAAG TGG (reversed) Intronic
901564019 1:10097118-10097140 TTGCTGTAAGAGTTAAATAGGGG + Intronic
902417908 1:16252801-16252823 CTGCTATCATATTTTCAAAGGGG - Intronic
903545322 1:24120358-24120380 CTTCTGTCATTGTTCAAAGGTGG - Exonic
903731428 1:25498579-25498601 CTGTTGTCATTTTTAAAAAGGGG + Exonic
904133487 1:28292791-28292813 CAGCTTTCATAGCTAAAAATTGG - Intergenic
905529739 1:38668073-38668095 GTGCTGTCACAGATACAAAGTGG + Intergenic
906516487 1:46442166-46442188 CTGCTGCCCTACTTCAAAAGGGG + Intergenic
914796171 1:150922326-150922348 CTGCTGTCTTAATTGAAAATAGG + Intergenic
917152153 1:171956918-171956940 CTCCAGTCATGGTTAAAAGGGGG - Intronic
917959061 1:180128218-180128240 CTGATGTCACAGTTAATAAGTGG + Intergenic
923223664 1:231919321-231919343 CAGCTGTAATAGTCAAAAACAGG + Intronic
923424706 1:233857532-233857554 CTGCTTTCATATTTAACATGTGG - Intergenic
924088113 1:240475190-240475212 CAGCTGTCATATTTAACATGGGG + Intergenic
1064118905 10:12602639-12602661 ATGCTGACATATTTAAATAGAGG - Intronic
1065638019 10:27751288-27751310 CTGGTGTCCTTTTTAAAAAGAGG - Intergenic
1065643364 10:27807553-27807575 CAGCTGCCATATTTAAAACGTGG + Intergenic
1066562067 10:36680185-36680207 CTTCTGTGGTAATTAAAAAGAGG - Intergenic
1067354164 10:45509521-45509543 CTTATGTCCTAGTAAAAAAGAGG - Intronic
1068581869 10:58750417-58750439 ATTCTGTCATAGTTTAACAGTGG - Intronic
1070354266 10:75624406-75624428 ATGCTGTGATAGAGAAAAAGAGG + Intronic
1070551628 10:77494968-77494990 CTGGTGTCATATTTATAAAAAGG - Intronic
1071732148 10:88258882-88258904 CTGCTGTGATTGTGAAAATGTGG + Intergenic
1076002915 10:126926674-126926696 CTGGTGTCCTTGTTAAGAAGAGG + Intronic
1076003188 10:126928457-126928479 CTGGTGTCCTTGTTAAGAAGAGG + Intronic
1077274152 11:1695657-1695679 CTGCTGTCTTGGTTGGAAAGAGG - Intergenic
1078497428 11:11833389-11833411 CTTCTGTCTAAGTTAAAGAGTGG - Intergenic
1079352673 11:19705125-19705147 CTTCTGTAATAGTGAAAAAGTGG + Intronic
1083156428 11:60826138-60826160 CTATTGTCAAAGTTAAAATGGGG + Intergenic
1084711647 11:70847452-70847474 CTGCTGTCAGCGTTAAAAATAGG + Intronic
1085481041 11:76822850-76822872 CATCTGTAATAGTCAAAAAGGGG + Intergenic
1086482172 11:87253448-87253470 CTGATGTCAAAGTTCAAAAGTGG + Intronic
1089930848 11:122309715-122309737 CTACTCTCAGAGTGAAAAAGAGG - Intergenic
1091108132 11:132942367-132942389 CTGCTGTCATAATTTACAATAGG + Intronic
1098421042 12:70298381-70298403 GTACTATCATGGTTAAAAAGGGG + Intronic
1098444304 12:70550590-70550612 CTGCTTACACAGTTAAAAAGTGG + Intronic
1102198047 12:111038300-111038322 CTGCTGTCATCTATAGAAAGAGG - Intronic
1104521059 12:129475637-129475659 CTGCTTACATAATTCAAAAGAGG + Intronic
1109710227 13:66149563-66149585 CTACTGTTAAAATTAAAAAGGGG + Intergenic
1109743639 13:66589733-66589755 CAGCTGTTATAGTTGAAAATAGG - Intronic
1112659461 13:101490955-101490977 CTGGTCTCATTGTTAATAAGTGG + Intronic
1112712810 13:102149903-102149925 GTGCTGTCATAGCTAAGTAGAGG - Intronic
1112770726 13:102792089-102792111 CTGATGTCTTAGTTTAAAGGAGG + Intronic
1113170604 13:107498417-107498439 TTCCTGTCATTGTTAAAAAATGG + Intronic
1114422676 14:22597982-22598004 CTTCTCTCATAACTAAAAAGTGG - Intergenic
1114575672 14:23710706-23710728 CTGCTGACATAGTTTATGAGAGG - Intergenic
1116013727 14:39381520-39381542 CAGCTGTCATGGTGAAAAAAGGG + Intronic
1116048285 14:39771688-39771710 TTGCTCTAATATTTAAAAAGAGG - Intergenic
1117660122 14:57995444-57995466 TCTCTGTCATTGTTAAAAAGAGG - Intergenic
1118553723 14:66988365-66988387 CTGCTGACATAACTAACAAGGGG - Intronic
1120011389 14:79419585-79419607 CTGCTGCCACATTTAAAGAGGGG + Intronic
1120841005 14:89084725-89084747 CTGGTGTCCTGATTAAAAAGGGG - Intergenic
1125864502 15:43033011-43033033 CTGATTTCATAGTTTAAATGAGG - Intronic
1126427589 15:48546310-48546332 CTGCTGTCATAGAGAATAATTGG + Intronic
1126878583 15:53070634-53070656 CTGCTGTCAGAGCTGAAAATTGG - Intergenic
1128331116 15:66756308-66756330 ATGCTGTCACAGTTAAAATAAGG + Intronic
1128878503 15:71222087-71222109 CTGCTTTCAGAGTTATAAAAGGG - Intronic
1131729113 15:95260376-95260398 CTTCTGTCAAAGTTAAAACTTGG - Intergenic
1131815246 15:96215129-96215151 CTGCTTTTATGTTTAAAAAGTGG - Intergenic
1133979728 16:10624195-10624217 CTTCTGTCATTATTTAAAAGAGG - Intergenic
1134847674 16:17454450-17454472 GTGCTGTCATAGCACAAAAGCGG + Intronic
1135241969 16:20815406-20815428 CAGTTGTCATCTTTAAAAAGAGG + Intronic
1139896257 16:70289823-70289845 CAATTGACATAGTTAAAAAGGGG + Intronic
1140685006 16:77425154-77425176 CTGCAGTCATAGTCTAAAAAAGG + Intronic
1140778497 16:78272713-78272735 CTGCTGTTATAGGTAAAAATGGG - Intronic
1142704583 17:1686485-1686507 CTGGTTTCATAGAAAAAAAGTGG + Intergenic
1148879917 17:50717994-50718016 CTGCTTTCCTTCTTAAAAAGAGG + Intergenic
1151101040 17:71555392-71555414 AGGCTGAGATAGTTAAAAAGAGG + Intergenic
1151856431 17:76725578-76725600 CTGCTGTCAAAGATGTAAAGGGG + Exonic
1156678818 18:39565007-39565029 CTGATCTCATAGGTAAAAAGGGG + Intergenic
1156819173 18:41351404-41351426 CTTCAGTCACAGTTAAAAGGTGG + Intergenic
1158051167 18:53221929-53221951 CAACTGTCATATTTAATAAGAGG + Intronic
1159077521 18:63698689-63698711 CTGCTGTTATAGGTAAGAAATGG - Intronic
1159516152 18:69460861-69460883 CTGCTCTGACAGTTAAAAAGTGG - Intronic
1159815285 18:73066016-73066038 CTGCTGAAATACTTAAAAATAGG - Intergenic
1160152641 18:76406763-76406785 CTGCTGTGATGGTGAGAAAGAGG - Intronic
1162790144 19:13058480-13058502 CTCTTCTAATAGTTAAAAAGGGG + Intronic
1165393601 19:35551838-35551860 CTGCTTTCATAGTGAAAGGGGGG + Intronic
1166780133 19:45337802-45337824 ATGCTGTCTTAATTAAAAAAAGG + Intronic
925773797 2:7311606-7311628 CTGGTGTCATAGACAAAGAGTGG - Intergenic
925795852 2:7541935-7541957 CTGCTTTCATAATTAAGTAGGGG + Intergenic
926426319 2:12741535-12741557 CTGCTATCTTAGTTTAAAGGGGG + Exonic
927762038 2:25766460-25766482 AATCTGTCAAAGTTAAAAAGAGG - Intronic
928406887 2:31021674-31021696 CTGCTGTTGTAGTGAGAAAGTGG - Intronic
929477568 2:42267456-42267478 CAGCTATCATTGTCAAAAAGAGG - Intronic
930615901 2:53593130-53593152 CTACTGTCAGAGTTACAAAATGG + Intronic
931527610 2:63174018-63174040 CTGCTGTTACAGTAAAAAAGTGG - Intronic
933264409 2:80166784-80166806 CTGGTGTCATAGTTGAATTGTGG + Intronic
935986472 2:108678357-108678379 CTGCTATCGTAGTTAGGAAGAGG + Intronic
936138921 2:109922021-109922043 CTGCTATCGTAGTTAGCAAGAGG + Intergenic
936205775 2:110449464-110449486 CTGCTATCGTAGTTAGCAAGAGG - Intronic
936655588 2:114482578-114482600 CTGCAGTCATATTTAAACAGAGG + Intronic
936959867 2:118061709-118061731 CTGCTGTGGTTTTTAAAAAGAGG + Intergenic
938192176 2:129293435-129293457 CTGTTGGCATAGTTACAAAGTGG + Intergenic
940017135 2:149118723-149118745 GTTTTGTCATAGTTAAAATGGGG - Intronic
941885061 2:170519519-170519541 CTGCTGTCACAGAGAAAAATGGG + Exonic
942224731 2:173805208-173805230 CTGATGGCATAGTTATAATGGGG + Intergenic
942862386 2:180630624-180630646 CTACTGTGATAGTTAAAATTAGG + Intergenic
946483914 2:220082398-220082420 CGTCTGTCAGAATTAAAAAGAGG - Intergenic
947163450 2:227237560-227237582 CTGCTGTCATAGTTAAAAAGTGG - Intronic
948202050 2:236136417-236136439 CTCCTGTCACAGTTATAATGAGG - Intergenic
1169163058 20:3398947-3398969 CTGCTGTCATAGCTAATACATGG + Intronic
1169736270 20:8840787-8840809 CTGATTTCAAATTTAAAAAGGGG - Intronic
1172634644 20:36401767-36401789 CTGCTGTGACAGAGAAAAAGAGG + Intronic
1173409803 20:42800044-42800066 CTGTTGTTATTGTTAAGAAGAGG - Intronic
1174797296 20:53532879-53532901 CTGCAGACATATTTAAAAAGGGG - Intergenic
1177678682 21:24336275-24336297 CAGCTGTCAGATTTAAAAAATGG - Intergenic
1179031584 21:37724965-37724987 TTTCTGTCATGGTTAAAAAAAGG - Intronic
1179078533 21:38147704-38147726 CTGCTGTCATAGAACAAAACTGG - Intronic
952199595 3:31112294-31112316 CTGCTGTTGTAGTTCAAAAGCGG + Intergenic
952590447 3:34947008-34947030 CTACTGTTATAGTTAGAAATAGG - Intergenic
952649971 3:35713876-35713898 CAGCTCTCATAGTTGGAAAGTGG - Intronic
953495812 3:43386160-43386182 CTACTCTCCTAGCTAAAAAGAGG - Intronic
954669866 3:52284517-52284539 CTGCTGGGATAGGTAAGAAGTGG - Intronic
955913923 3:63886971-63886993 TTGCTGTCCTAGTTAATCAGAGG + Intronic
956414140 3:69009728-69009750 ATGCTGGCATAGTTATACAGAGG + Exonic
957880199 3:86201955-86201977 CTGCTGTCATTGACAAATAGAGG + Intergenic
957919482 3:86730298-86730320 CTGATGTCATATTTTCAAAGTGG - Intergenic
958541957 3:95489085-95489107 CTGCAGTGAAAGCTAAAAAGAGG + Intergenic
958686295 3:97401199-97401221 TTGATGTGATAGTTAAAAATTGG + Intronic
959007066 3:101031610-101031632 CTGCTGTCAAATTTAAAACTAGG - Intergenic
959516709 3:107275270-107275292 ATGCAGTCACAGTTCAAAAGAGG + Intergenic
961472320 3:127123627-127123649 CTGCTGTCATAGTGTGAAAGTGG + Intergenic
963669111 3:148229946-148229968 CTGGTGTCCTTATTAAAAAGAGG - Intergenic
963674029 3:148286135-148286157 CTGTTGTCATAGGTAAACAAAGG - Intergenic
963893037 3:150657400-150657422 CTGCTATCGTTGTGAAAAAGAGG - Intergenic
964329795 3:155589775-155589797 CTGCTGTCATTGCTAAAAAGAGG - Intronic
967877857 3:194279021-194279043 TTGCTGTCATGTTTAAAAGGAGG - Intergenic
969174480 4:5388052-5388074 CCATGGTCATAGTTAAAAAGTGG - Intronic
970172045 4:13300056-13300078 CTGCTGTCATGGTTCACATGCGG + Intergenic
970960874 4:21869957-21869979 ATTCTGTCATAGTAAATAAGTGG + Intronic
971137663 4:23887502-23887524 TAGCTGTCATAGTTGCAAAGAGG - Intronic
978105474 4:104897027-104897049 CTGCTCTCATAGTTCAGAATGGG - Intergenic
978494915 4:109348294-109348316 CAGCTCTCATAATTGAAAAGAGG + Intergenic
979443280 4:120778386-120778408 TGGCTGTCATAGAGAAAAAGGGG + Intronic
979667307 4:123326427-123326449 CTACTGTCAGGGTAAAAAAGGGG - Intergenic
980636247 4:135507926-135507948 CTGCTGTTTTTTTTAAAAAGGGG - Intergenic
981154022 4:141412827-141412849 CTGCTGTCACATTTAGAAAAGGG - Intergenic
981318045 4:143361070-143361092 CTGTTGGCATAGTTAAGCAGGGG + Intronic
984106702 4:175556579-175556601 CTGTAGTAATTGTTAAAAAGGGG + Intergenic
984853846 4:184176378-184176400 CTGCTTTCCTATTTAAGAAGAGG - Intronic
985822754 5:2171124-2171146 CCGCAGTCATGCTTAAAAAGAGG - Intergenic
989484918 5:41978187-41978209 TTGCTCTTATAGTTCAAAAGAGG - Intergenic
991246529 5:64514167-64514189 CTACTGTCCTTGTAAAAAAGAGG - Intronic
993121554 5:83780604-83780626 CTGCTGTCATAGATGTAAAATGG - Intergenic
993279041 5:85901421-85901443 CTGGTGTCATTTTTAAAAATTGG - Intergenic
996047726 5:118894191-118894213 CTTCTATCAGAGTTTAAAAGTGG - Intronic
997879932 5:137580490-137580512 GTGCTGTAAGAGTTAAGAAGAGG + Intronic
1001069087 5:168568589-168568611 CTACTCTCATATTTAAAAACAGG + Intronic
1001831036 5:174789598-174789620 CTGCTGTCATAGCACAAAAGTGG - Intergenic
1004555789 6:16696512-16696534 ATGCTGACATTGTTAGAAAGGGG - Intronic
1004680244 6:17886869-17886891 TTGTTGTCGTTGTTAAAAAGAGG + Intronic
1008120097 6:47604362-47604384 TTGGTGTCATAGTTCAAAACTGG + Intronic
1009334515 6:62470147-62470169 CTGCTGTCTTAGTCTAAGAGTGG - Intergenic
1015553571 6:134437618-134437640 CTTCATTCATAGCTAAAAAGTGG - Intergenic
1017021062 6:150141186-150141208 CTCCTGCCATAATTACAAAGGGG - Intergenic
1018489136 6:164273656-164273678 CTGCTGTCGTAGCACAAAAGTGG - Intergenic
1018523278 6:164677559-164677581 CAGCTGTCATAAATAAAAATTGG + Intergenic
1020407428 7:7853334-7853356 CTGATTTCATTGTAAAAAAGTGG - Intronic
1023649599 7:42355110-42355132 CTGCAGACAGAGTTAATAAGTGG - Intergenic
1024002282 7:45198445-45198467 CTGCTGTATTAGTTAAATAATGG - Intergenic
1027585987 7:80059108-80059130 CTGCTCTCATAGGTGAAAGGTGG - Intergenic
1027759553 7:82260755-82260777 TTGATGTCATTGTTAAAAACAGG - Intronic
1028286257 7:89005639-89005661 CTGCTATCAGAGTCAATAAGTGG - Intronic
1029871296 7:103695746-103695768 CTGCTGTCATTGTTCAACACTGG - Intronic
1030477102 7:110049740-110049762 CTGCTCTCAAAGTCAAAGAGAGG + Intergenic
1030840941 7:114353490-114353512 CTGCTTTCATAATGGAAAAGGGG - Intronic
1032687312 7:134248612-134248634 CTGCTATAAAAGTTAAAAATAGG - Intronic
1033911616 7:146269951-146269973 CTGCTGTCTTTGTTAAACATGGG + Intronic
1037198928 8:16226002-16226024 CTGTTGTTATAGTTAAACATTGG + Intronic
1037481515 8:19310626-19310648 CTGCTCTAACAGTTAAAAAGTGG + Intergenic
1039086681 8:33787117-33787139 GTGCTGTCATCGTTACAATGGGG + Intergenic
1039123104 8:34170812-34170834 CAGATGATATAGTTAAAAAGAGG - Intergenic
1041258546 8:56000418-56000440 GTGCTGGCATGGTTAAGAAGAGG + Intronic
1043098581 8:76009611-76009633 CAGCTCTCATAGTTACAAAGTGG - Intergenic
1048374419 8:133810485-133810507 CTGGTCTCACAGTCAAAAAGAGG + Intergenic
1050839399 9:10128287-10128309 CAGCTGCAATAGTTAAAATGAGG + Intronic
1053311819 9:37025361-37025383 CTGCTGCCTTTGTTAAATAGGGG + Intronic
1187088517 X:16067951-16067973 CTGCTGTCTTATTTACAATGGGG - Intergenic
1188283430 X:28298661-28298683 CTGATATCATAATTAAAAAAAGG + Intergenic
1189055067 X:37690491-37690513 CTGCTATGATACTTGAAAAGTGG + Intronic
1189743381 X:44144298-44144320 CTCCAGTCATAGTTAAAACTGGG + Intergenic
1190119956 X:47651242-47651264 CTGCGGCCAGAGTTAAAAAGGGG + Intergenic
1192989285 X:76431539-76431561 GTGCTATGGTAGTTAAAAAGAGG + Intergenic
1194286546 X:92018115-92018137 CTGCTGTCATAGCTGATGAGAGG + Intronic
1194573103 X:95576620-95576642 ATGCTGTCATAAAAAAAAAGAGG - Intergenic
1198647014 X:138819600-138819622 TTAATGTCATATTTAAAAAGCGG - Intronic
1200604091 Y:5242672-5242694 CTGCTGTCATAGCTGATGAGAGG + Intronic