ID: 947163872

View in Genome Browser
Species Human (GRCh38)
Location 2:227241761-227241783
Sequence CTGCATATGTACTCTGTGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 617
Summary {0: 1, 1: 0, 2: 6, 3: 86, 4: 524}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947163869_947163872 -9 Left 947163869 2:227241747-227241769 CCAAAGCCAACCTACTGCATATG 0: 1
1: 0
2: 1
3: 10
4: 115
Right 947163872 2:227241761-227241783 CTGCATATGTACTCTGTGCCAGG 0: 1
1: 0
2: 6
3: 86
4: 524

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947163872 Original CRISPR CTGCATATGTACTCTGTGCC AGG Intronic
900508090 1:3039773-3039795 CTGCATATGTGTTCTGTGTATGG + Intergenic
901158884 1:7159926-7159948 CTGAAAGTGTACTATGTGCCAGG - Intronic
901681478 1:10915491-10915513 CTGAACACTTACTCTGTGCCAGG - Intergenic
902506570 1:16942528-16942550 CTGCACACCTACTGTGTGCCAGG + Intronic
902669523 1:17963165-17963187 CTGAATGTCCACTCTGTGCCAGG - Intergenic
902929699 1:19722399-19722421 CTCAGTATGTACTATGTGCCAGG + Intronic
903036589 1:20496996-20497018 CTGAATGTGTATTTTGTGCCTGG - Intergenic
903670457 1:25032290-25032312 CTGAACATTTACTGTGTGCCAGG + Intergenic
903804190 1:25992516-25992538 CATCATACTTACTCTGTGCCAGG + Intronic
905043704 1:34979812-34979834 CTGAACATTTACTATGTGCCAGG + Intergenic
905274957 1:36811534-36811556 CTGCATGCCTACTTTGTGCCAGG + Intronic
905363886 1:37438376-37438398 CTGAATACCTACTGTGTGCCAGG - Intergenic
905859649 1:41341782-41341804 CTGCATAGGTCCTCTGTGCCAGG + Intergenic
905937003 1:41832671-41832693 CTAAATATCTACTATGTGCCAGG - Intronic
906717230 1:47979278-47979300 CTGCATGTGTACTCAAAGCCAGG + Intronic
906803644 1:48759130-48759152 CTGTCCATGTCCTCTGTGCCTGG + Exonic
906899001 1:49812784-49812806 CTGCAGAACTACTATGTGCCAGG + Intronic
907330650 1:53669170-53669192 CTGAACATGTCCTCTGTGCCTGG + Intronic
907330737 1:53669564-53669586 CTGAATATCCACTCTATGCCAGG + Intronic
907350075 1:53821811-53821833 CTAAATATTTACTGTGTGCCAGG + Intronic
907457610 1:54585518-54585540 CTGAGTGTGTACTATGTGCCAGG + Intronic
907484990 1:54771408-54771430 CTGGATGAGCACTCTGTGCCGGG - Intergenic
907760787 1:57357064-57357086 TTGAACATGTACTGTGTGCCAGG - Intronic
907919725 1:58901298-58901320 CTGAATACCTACTCTGAGCCAGG + Intergenic
907943917 1:59115352-59115374 CTGAGTGTCTACTCTGTGCCAGG - Intergenic
907966062 1:59331026-59331048 CAGGATATGTTCTCTGTGTCTGG + Intronic
908075128 1:60508726-60508748 CTGAATGTGTGCTGTGTGCCAGG - Intergenic
908137142 1:61144756-61144778 CTGAGCATGTACCCTGTGCCAGG - Intronic
908186320 1:61656175-61656197 CTGAATATCTATTATGTGCCAGG + Intergenic
908383974 1:63623039-63623061 CTGCATTTGCCCTCTTTGCCTGG + Intronic
908596878 1:65697600-65697622 CTGAACACCTACTCTGTGCCAGG + Intergenic
908855594 1:68423399-68423421 CTGATTATCTACTGTGTGCCAGG - Intergenic
908952676 1:69580693-69580715 CTAAATATTTACTGTGTGCCAGG + Intronic
909116999 1:71549923-71549945 ATGCATGTCTAATCTGTGCCAGG + Intronic
909470589 1:76023472-76023494 CTGAACATCTACTATGTGCCAGG - Intergenic
909502335 1:76348909-76348931 CTGAGTATGTACTATGAGCCAGG - Intronic
909583545 1:77264157-77264179 ATGCATGTCTACTCTGAGCCAGG - Intergenic
911089761 1:94009217-94009239 CTGAGTCTTTACTCTGTGCCAGG - Intronic
911468766 1:98289818-98289840 TTGCATATTTACTCTGTATCTGG + Intergenic
911777480 1:101832657-101832679 CTGAACACTTACTCTGTGCCTGG - Intronic
912164918 1:107031508-107031530 ATGCATATGTATTATGTGCCAGG - Intergenic
912469738 1:109898311-109898333 CTTAATATTTACTATGTGCCTGG - Intergenic
912777049 1:112512263-112512285 TTGCATACCTACTATGTGCCAGG + Intronic
912948774 1:114106264-114106286 TTGCACATGGACTGTGTGCCAGG + Intronic
913359689 1:117966402-117966424 CTGCACATATACTATGTGTCAGG + Exonic
914700743 1:150130823-150130845 TTGAATATATACTATGTGCCAGG + Intronic
914916325 1:151821479-151821501 CTGAATTCTTACTCTGTGCCAGG + Intronic
915513126 1:156397679-156397701 CTGAAAATGTAGTCTGTGTCAGG - Intergenic
917455554 1:175182830-175182852 CTGAAGATGTGCTCTGTGCCAGG - Intronic
918320554 1:183360212-183360234 CTTCATATTTCCTCTGTTCCAGG - Intronic
920698807 1:208202329-208202351 TTGAATATGTACTGTGTGCCAGG - Intronic
921783267 1:219194655-219194677 CTGAGTATTTGCTCTGTGCCAGG - Intronic
922279577 1:224111047-224111069 CTTCATATGGAATCTGTTCCTGG - Intergenic
922581050 1:226698205-226698227 CTGAATATCCACTCTGTGCCAGG - Intronic
922736582 1:227986234-227986256 TTGCAGATTGACTCTGTGCCAGG - Intergenic
922899227 1:229123380-229123402 CTGCACACCTGCTCTGTGCCAGG + Intergenic
923674421 1:236067121-236067143 CTGAAGCTGTAGTCTGTGCCTGG + Intergenic
923805885 1:237257575-237257597 CTGAATATCTACTATGTGCTGGG + Intronic
1062791227 10:307830-307852 CTCCAGATGGACTGTGTGCCGGG - Intronic
1063005990 10:1971144-1971166 CTGCATTTGTCCTCTGAGCCAGG + Intergenic
1063606955 10:7531123-7531145 CTTAGTATCTACTCTGTGCCGGG + Intergenic
1063680686 10:8184695-8184717 CTGCCTCTGTACTCTAGGCCTGG + Intergenic
1064818877 10:19300797-19300819 CTGCTTATGAAATCTTTGCCAGG - Intronic
1065007957 10:21396838-21396860 CTTCATATCTACTATGTGCTTGG - Intergenic
1065463030 10:25989637-25989659 TTGCATACTTACTTTGTGCCAGG - Intronic
1066183122 10:32982422-32982444 CTGAATATCTATTATGTGCCAGG - Intronic
1066486957 10:35855323-35855345 GTGCATGTTTACTATGTGCCAGG - Intergenic
1066523823 10:36253459-36253481 GTGCATCTATTCTCTGTGCCTGG + Intergenic
1066749745 10:38641833-38641855 CTGAATACCTAATCTGTGCCAGG - Intergenic
1066966901 10:42275945-42275967 CTGAATACCTACTGTGTGCCAGG + Intergenic
1067336358 10:45368220-45368242 CTGCATGTGCACTATGTGTCTGG + Intergenic
1068342783 10:55729973-55729995 CTACATATGTATTCTGTGCTAGG - Intergenic
1068631846 10:59306405-59306427 CTGAATGTCTACTGTGTGCCTGG + Intronic
1068838315 10:61580774-61580796 CTGCATTTGTAGGCTGTCCCAGG + Intergenic
1069083065 10:64108709-64108731 CTGAGTATCTACTCTGTGCTTGG + Intergenic
1070005976 10:72424429-72424451 CTGAGTATGTACTATGGGCCAGG + Intronic
1070565140 10:77598358-77598380 CTGGATATTTACTGTGTGCTAGG - Intronic
1071250108 10:83809204-83809226 TTGAATAGGTACTCTGTGCCAGG - Intergenic
1071499488 10:86193319-86193341 CTGTGTAGTTACTCTGTGCCAGG - Intronic
1071798237 10:89028883-89028905 TTGTATTTCTACTCTGTGCCAGG + Intergenic
1072036536 10:91567899-91567921 CTGCATCTGTACCTTGTGACTGG - Intergenic
1073364099 10:102923292-102923314 TTACCTATGTATTCTGTGCCAGG + Intronic
1074115459 10:110454650-110454672 CTGCATATCTCCTCCATGCCAGG - Intergenic
1074149323 10:110744238-110744260 CTGCAAACCTACTGTGTGCCAGG - Intronic
1074828644 10:117232676-117232698 CTGAACTTTTACTCTGTGCCAGG + Intergenic
1075204938 10:120438853-120438875 CTGAATTCTTACTCTGTGCCAGG + Intergenic
1075209317 10:120477760-120477782 CTGAGTATCTACTATGTGCCAGG - Intronic
1075376525 10:121982296-121982318 CTGCATCTCTCCTCTCTGCCTGG - Intergenic
1075419167 10:122288187-122288209 CTGCATGCCTACTGTGTGCCAGG + Intronic
1075822533 10:125327136-125327158 CTGAGTATCTACTCTGTGCCAGG - Intergenic
1075991475 10:126842299-126842321 CTGAATACCTACTCTGTGCCAGG + Intergenic
1076722685 10:132399623-132399645 CTGCACACCTACTGTGTGCCAGG + Intronic
1077657986 11:4040641-4040663 CTGCATTCCTACTCTGGGCCAGG - Intronic
1077867131 11:6232029-6232051 TTCCATATCTGCTCTGTGCCAGG - Intronic
1078134135 11:8638365-8638387 TTGAACATGTACTCTGTGCTTGG - Intronic
1078402107 11:11037614-11037636 TTGCACATTTACTATGTGCCTGG + Intergenic
1078825464 11:14925823-14925845 CTGAATATCTACTATATGCCAGG + Intronic
1078976941 11:16488181-16488203 CTGGATGTTTACTCTGTGCCAGG + Intronic
1079575177 11:21995360-21995382 CTGTATATGTATTCTGTACCAGG + Intergenic
1080224728 11:29948039-29948061 TTGAATATGTACTATATGCCAGG + Intergenic
1080409847 11:32013153-32013175 CTGAATGCCTACTCTGTGCCAGG - Intronic
1080749776 11:35141057-35141079 CTGTATATTTTCACTGTGCCAGG + Intronic
1080759933 11:35238616-35238638 CTGAATATCTACTATATGCCAGG + Intergenic
1081730578 11:45369245-45369267 CTGAATACCTACTATGTGCCAGG - Intergenic
1082041309 11:47687489-47687511 TTGAATATTTACTGTGTGCCAGG - Intronic
1082890694 11:58135627-58135649 TTGCCTATTTGCTCTGTGCCAGG - Intronic
1082899621 11:58232783-58232805 TTGAATGTGTACTCTGTGCTGGG - Intergenic
1083395426 11:62388319-62388341 CTGCCTATGGACCCTGTGCATGG - Intronic
1083566488 11:63722475-63722497 CTGCATATTTACTATGTGCTAGG - Intronic
1083810099 11:65099359-65099381 CTGCACATCTACTATCTGCCTGG - Intronic
1083946758 11:65927932-65927954 CTGAGTACCTACTCTGTGCCGGG + Intergenic
1084587043 11:70068395-70068417 TTGCATACCTACTGTGTGCCAGG + Intergenic
1084900192 11:72303749-72303771 CTGGGTATTTACTATGTGCCTGG + Intronic
1085614503 11:77985687-77985709 CTGAATACTTACTCTGTGCCAGG - Intronic
1085733209 11:79017038-79017060 CTGGAAATTGACTCTGTGCCAGG - Intronic
1086434456 11:86767599-86767621 CTGATTATCTACTATGTGCCAGG - Intergenic
1087259638 11:95996162-95996184 CTGAATGTCTACTCTGTGCTAGG + Intronic
1088869657 11:113879833-113879855 CTGCATGGGGACTCTGGGCCTGG + Intergenic
1089399936 11:118158570-118158592 CTGAGTACCTACTCTGTGCCTGG - Intergenic
1090200106 11:124847910-124847932 CTGAATATCTTCTATGTGCCAGG + Intergenic
1091864822 12:3823490-3823512 CTGAGTGTGTACTATGTGCCAGG - Intronic
1092131806 12:6118199-6118221 CAGAACATGAACTCTGTGCCTGG + Intronic
1093609864 12:21141094-21141116 TTGAATATCTACTCTGTGCAAGG + Intronic
1094554122 12:31481594-31481616 TTGCACATGTCCTCTCTGCCTGG - Intronic
1095368023 12:41431234-41431256 GCACATACGTACTCTGTGCCAGG + Intronic
1095474071 12:42567208-42567230 CTGAATACATATTCTGTGCCAGG + Intronic
1095733757 12:45534655-45534677 CTACATGTGTACTGTGTGCTAGG - Intergenic
1095806950 12:46330185-46330207 CTGCATATGGCCTTTGTGACTGG - Intergenic
1095834809 12:46625985-46626007 CTGGGTACTTACTCTGTGCCAGG + Intergenic
1095914123 12:47458776-47458798 TTGAGTATGTACTATGTGCCAGG - Intergenic
1095977505 12:47949757-47949779 CTGCACATGCACTGGGTGCCAGG + Intergenic
1096394198 12:51253278-51253300 CTGAGTGTGTACTCTGTGCCAGG + Intronic
1096421393 12:51461336-51461358 TTGAATATTTACTCTGTGCCAGG + Intronic
1096768150 12:53911489-53911511 CTGAATGCGTACTTTGTGCCAGG + Intergenic
1096812062 12:54177098-54177120 CTGAATACCTACTTTGTGCCAGG + Intronic
1096968145 12:55645029-55645051 CTGAATACCTACTATGTGCCAGG + Intergenic
1097874102 12:64627547-64627569 CTCCCTCTGTCCTCTGTGCCAGG - Intronic
1098269983 12:68760727-68760749 CTGAACATCTACTGTGTGCCAGG + Intronic
1098291325 12:68959211-68959233 CTGAAGACTTACTCTGTGCCAGG - Intronic
1098457745 12:70694164-70694186 TTGCATATCTACTCTGTGCTAGG + Intronic
1099240424 12:80131604-80131626 CTGCATATTTACTGTGTGCTAGG + Intergenic
1099415722 12:82383573-82383595 CTGTATGTATACTATGTGCCAGG - Intronic
1100727706 12:97426580-97426602 TTGAATATTTACTGTGTGCCAGG + Intergenic
1101368619 12:104102022-104102044 CTGAATCTGTATCCTGTGCCTGG - Exonic
1101405366 12:104423913-104423935 TTGAAAATTTACTCTGTGCCAGG + Intergenic
1102010111 12:109612982-109613004 CTGCTGGTGTACTCTGTCCCTGG + Intergenic
1102701127 12:114840315-114840337 GTGCTTATGTACTCTATACCAGG + Intergenic
1102749760 12:115282277-115282299 CTGCATACGTACTATGTCCCAGG - Intergenic
1103066273 12:117900519-117900541 TTGAAAATGTACTGTGTGCCAGG + Intronic
1103356080 12:120321604-120321626 CTGATTATTTACTCTGTACCAGG - Intergenic
1103376728 12:120462262-120462284 CTTACTGTGTACTCTGTGCCTGG + Exonic
1104093622 12:125536605-125536627 CTGAATATCTACCATGTGCCAGG - Intronic
1104466151 12:128992725-128992747 CTGAACAGCTACTCTGTGCCAGG + Intergenic
1104640560 12:130464372-130464394 CTGAATACCTACTATGTGCCAGG + Intronic
1104640572 12:130464468-130464490 CTGAATACCTACTATGTGCCAGG + Intronic
1105842072 13:24262687-24262709 CTGCACACTTACTGTGTGCCAGG - Intronic
1106240428 13:27907880-27907902 CTAAATATCTACTCTGTGCCAGG - Intergenic
1106920238 13:34555557-34555579 CTGAACATCTACTCTGTGCTAGG + Intergenic
1107596294 13:41966228-41966250 CTGAATACCTACTGTGTGCCAGG - Intergenic
1107900379 13:45006853-45006875 CTATATACTTACTCTGTGCCAGG - Intronic
1108327757 13:49351048-49351070 CTGAAGATCTACTATGTGCCTGG + Intronic
1108401666 13:50051295-50051317 TTGAATATCTACTATGTGCCAGG + Intergenic
1108621687 13:52191179-52191201 GTGAATATCTACTCTGTGCTGGG + Intergenic
1108665052 13:52621004-52621026 GTGAATATCTACTCTGTGCTGGG - Intergenic
1108780707 13:53827879-53827901 TTGAATGTTTACTCTGTGCCAGG - Intergenic
1110105753 13:71674103-71674125 TTGAATATCTGCTCTGTGCCAGG + Intronic
1111633257 13:90870573-90870595 CAGTATTTGTCCTCTGTGCCTGG + Intergenic
1113081485 13:106525034-106525056 TTGAATATGTACTGTGTGCCTGG - Intronic
1113100684 13:106714274-106714296 TTGCCTGTGTACTCTGTGCATGG + Intergenic
1113640445 13:111953396-111953418 CTGCATGTGTGTTCTGAGCCTGG - Intergenic
1115106818 14:29771514-29771536 CTGCTTGTGCACTCTGTGCATGG - Intronic
1116409721 14:44607169-44607191 TTACATATGTACTCTGTGTCTGG + Intergenic
1117434392 14:55702308-55702330 CTGAACACTTACTCTGTGCCAGG - Intergenic
1118581754 14:67307491-67307513 ATGATTATGTACTCTGTGCCAGG + Intronic
1118779557 14:68998053-68998075 CTGCATTCTTACTGTGTGCCAGG - Intergenic
1118810339 14:69268584-69268606 CTGAGCATGTACTATGTGCCAGG + Intronic
1119115837 14:72020657-72020679 CTGAATATGTTTTGTGTGCCAGG + Intronic
1119571377 14:75676503-75676525 GTTCATATATACTCTGTGTCCGG - Intronic
1119646458 14:76352071-76352093 CAACAAATCTACTCTGTGCCAGG - Intronic
1119648219 14:76364033-76364055 CTGCACACCTACTCTGTGCTGGG - Intronic
1119902193 14:78270683-78270705 CTGAATGTTTACTATGTGCCTGG + Intronic
1120761537 14:88289850-88289872 CTGAGTATTTACTATGTGCCAGG - Intronic
1121742111 14:96261343-96261365 CTGAGAATGTACTATGTGCCAGG - Intronic
1122021200 14:98839337-98839359 GTGAATATCTACTTTGTGCCAGG - Intergenic
1122261102 14:100523553-100523575 CTACAGATTTACTATGTGCCTGG - Intronic
1122279423 14:100612441-100612463 TTGCATACTTACTGTGTGCCAGG + Intergenic
1122371975 14:101233973-101233995 CTGCAGATGTACCCTCTGCTGGG + Intergenic
1123011298 14:105350781-105350803 CTGCAAATGTGCTCTGCGTCGGG - Intronic
1123834834 15:24178671-24178693 CTGTGTTTGTTCTCTGTGCCAGG - Intergenic
1123854527 15:24394335-24394357 CTGTGTTTGTTCTCTGTGCCAGG - Intergenic
1125738226 15:41943357-41943379 CAGCATCTGTTCTCTGTGGCTGG - Intronic
1125985388 15:44046097-44046119 CTGAGTATGTACTCTGTCCAGGG - Intronic
1126181735 15:45792160-45792182 CTGGATATCTACTATGTTCCTGG + Intergenic
1126198864 15:45962421-45962443 CAACATCTGTACTCTGTACCTGG - Intergenic
1126499798 15:49332872-49332894 TTGCATTTGTGCTCTGTGACTGG + Intronic
1127141692 15:55984454-55984476 CTGAATACCCACTCTGTGCCAGG - Intronic
1127334171 15:57967346-57967368 CTGCACACTTACTGTGTGCCAGG - Intronic
1127722855 15:61719881-61719903 CTGAATGTCTACTTTGTGCCAGG - Intergenic
1128318622 15:66677531-66677553 CTGCATGCCTACTATGTGCCAGG - Intronic
1128413764 15:67424556-67424578 CTGAATACCTACTTTGTGCCAGG - Intronic
1129367918 15:75068379-75068401 ATGTATATGTGCTCTGTGCTAGG + Intronic
1130135061 15:81175503-81175525 CTGAGTGTTTACTCTGTGCCAGG - Intronic
1130310801 15:82752376-82752398 CTGTTTGTGTTCTCTGTGCCTGG - Intergenic
1130520813 15:84659250-84659272 TAGCATAAGTACTCTGTGGCCGG + Intergenic
1131984477 15:98028075-98028097 CTGAGTACATACTCTGTGCCAGG + Intergenic
1132988797 16:2782627-2782649 CTGAGTATGTGCACTGTGCCAGG - Intergenic
1133826065 16:9279298-9279320 CTGAGTATCTACTATGTGCCGGG - Intergenic
1133899847 16:9963783-9963805 CTATATAGCTACTCTGTGCCAGG + Intronic
1134636733 16:15798361-15798383 TTGAACATGTACTCTGTGCCAGG - Intronic
1134683725 16:16144354-16144376 CTGCACATGTACTTGGTGCATGG - Intergenic
1135754532 16:25086012-25086034 CTGCACATCTAGTCTGGGCCAGG + Intergenic
1136516598 16:30772339-30772361 CTGTACATGTACTGTGAGCCAGG + Intronic
1136732970 16:32435319-32435341 CTGAATACCTACTCTGTGCCAGG + Intergenic
1137917583 16:52449634-52449656 CTGTATACCTACTCTGTGCTTGG - Intronic
1138127000 16:54447330-54447352 CTGCATGTCTACTCTCTGCTGGG - Intergenic
1138480681 16:57301167-57301189 CTGCGTACCTACTGTGTGCCGGG - Intergenic
1140795627 16:78434868-78434890 TTGCTTAGGGACTCTGTGCCAGG + Intronic
1203020111 16_KI270728v1_random:394284-394306 CTGAATACCTACTCTGTGCCAGG - Intergenic
1203038446 16_KI270728v1_random:667442-667464 CTGAATACCTACTCTGTGCCAGG - Intergenic
1143039193 17:4020372-4020394 TTGCATGTATGCTCTGTGCCAGG + Intronic
1143423912 17:6817841-6817863 CTGAGCATGTACTATGTGCCAGG - Intronic
1143653514 17:8279158-8279180 CTCCATAAGGACCCTGTGCCTGG - Intergenic
1144158895 17:12537484-12537506 CTACAAATGTACTCTATGCTCGG + Intergenic
1146208616 17:30924635-30924657 CTGAATGCCTACTCTGTGCCAGG + Intronic
1146467846 17:33100740-33100762 CTGCATACCTACTGTGTGCCAGG - Intronic
1146570164 17:33945628-33945650 CTGCATATGGCTTCTGTGTCAGG + Intronic
1146629049 17:34457133-34457155 CTGCATGTCTACTGTGTGCTAGG - Intergenic
1149245005 17:54695523-54695545 TTGAATATCTACTTTGTGCCAGG + Intergenic
1149473102 17:56935399-56935421 CTGCACATCTGCTGTGTGCCAGG + Intergenic
1149954189 17:61027830-61027852 CTGCACATTTACTATGTGCCAGG - Intronic
1150932225 17:69597354-69597376 CTGAATATGTGCTGTGTACCAGG + Intergenic
1151177300 17:72299399-72299421 TTAAATATGTACTCTGTGCCAGG - Intergenic
1151347179 17:73509301-73509323 CAGAACATGTACTCTGGGCCGGG - Intronic
1151773457 17:76180502-76180524 CTGAGTATCTACTATGTGCCAGG + Intronic
1153736980 18:8081433-8081455 CTGTACTTGTACTCTGTCCCTGG - Intronic
1153901331 18:9619625-9619647 CTCCACACGTACTCTGTGCCAGG - Intergenic
1154170286 18:12046485-12046507 CTGCCTAGCTGCTCTGTGCCAGG - Intergenic
1155248706 18:23935737-23935759 ATGCATACTTACTATGTGCCAGG - Intronic
1155612979 18:27689412-27689434 CTGCTTATGTCCTTTGTGCCAGG + Intergenic
1155695094 18:28675916-28675938 TTGCATATTTACTGTGTGCCTGG + Intergenic
1155732751 18:29181283-29181305 CTGCATATTTACTGAGTCCCTGG + Intergenic
1155793311 18:30001185-30001207 TTGGATACCTACTCTGTGCCTGG + Intergenic
1156350957 18:36300426-36300448 CTGACTATGCACTCTGTGTCAGG - Intronic
1157104919 18:44764939-44764961 TTGAACATGCACTCTGTGCCAGG - Intronic
1157518509 18:48328503-48328525 CTGCATATCTACTATATACCTGG + Intronic
1157599140 18:48882971-48882993 TTGAGCATGTACTCTGTGCCAGG + Intergenic
1158409969 18:57197094-57197116 CTGGGTATCTACTCTGAGCCAGG - Intergenic
1158671266 18:59476033-59476055 CTGAATGCTTACTCTGTGCCAGG + Intronic
1158800757 18:60905824-60905846 CTGCATATCTCCTCAGTGCCGGG + Intergenic
1161090705 19:2358628-2358650 CTGAGTATGTGCTGTGTGCCCGG - Intergenic
1161733288 19:5975537-5975559 CTGTGTACCTACTCTGTGCCAGG + Intronic
1163037574 19:14579836-14579858 CTGAATACCTACTGTGTGCCAGG + Intergenic
1164690537 19:30207704-30207726 CTGAGCATGTACTATGTGCCAGG - Intergenic
1165041616 19:33072082-33072104 CTGCATACTTATTCCGTGCCAGG + Intergenic
1165267444 19:34672954-34672976 CAGCATATGAATTCTGTGGCGGG + Intronic
1165279316 19:34783083-34783105 CACCAAATGTACTCTGGGCCTGG + Intergenic
1165898590 19:39157503-39157525 CTGCGCATGTACTCTGAGCCAGG + Intronic
1165968825 19:39607841-39607863 CTGTGTATGAACACTGTGCCCGG + Intergenic
1166693396 19:44838133-44838155 CTGCACATGGACTCTGTGCCAGG - Intergenic
1168431445 19:56284363-56284385 CTGAGTATCTAGTCTGTGCCTGG + Intronic
925217184 2:2107112-2107134 CTGCTTCTGAACTGTGTGCCAGG - Intronic
925489945 2:4380219-4380241 CTGAATTTCTACTCTGTGCCTGG + Intergenic
926333311 2:11843888-11843910 TTGGATATGTACTCTGTGTCAGG - Intergenic
926624512 2:15079856-15079878 TTAGTTATGTACTCTGTGCCTGG - Intergenic
926844362 2:17119127-17119149 CTGCATTTCTACTGTGTGCCAGG + Intergenic
927051290 2:19331870-19331892 CTGAATAACTACTGTGTGCCAGG + Intergenic
927911844 2:26905326-26905348 TTGTATATGTATTCTGTGACAGG - Intronic
927934395 2:27067840-27067862 CTGAACATTTACTATGTGCCAGG + Intronic
928061712 2:28120205-28120227 TTGAATATCTACTGTGTGCCTGG + Intronic
928587023 2:32770200-32770222 CTGAGTATTTACTCAGTGCCAGG + Intronic
928615358 2:33033106-33033128 TTGAATATTTACTGTGTGCCAGG + Intronic
928751384 2:34474579-34474601 TTGCATATGTACTGTGTTACAGG + Intergenic
928810173 2:35214628-35214650 CTTAATAGGAACTCTGTGCCAGG - Intergenic
928895124 2:36252929-36252951 CTAAGTATCTACTCTGTGCCTGG + Intergenic
929308697 2:40397159-40397181 TTGGATATCTACTATGTGCCAGG - Intronic
929841224 2:45466007-45466029 CTGAATATCTACCATGTGCCAGG + Intronic
930094903 2:47559664-47559686 CTGCATACCTACTATGTGCTGGG + Intronic
930701519 2:54462171-54462193 CTAAATACGTACTATGTGCCTGG - Intronic
930768551 2:55109780-55109802 GGGCATATTTACTCTCTGCCTGG - Intronic
931853956 2:66282061-66282083 CTTCATATTTACTCTCTGCATGG + Intergenic
931873058 2:66482188-66482210 CTGAAAATCTACTATGTGCCAGG + Intronic
932347942 2:71007746-71007768 CTGCTTGTGTAGTCAGTGCCTGG - Intergenic
932455742 2:71848869-71848891 CTGAGCATGTACTATGTGCCAGG + Intergenic
933160273 2:79016149-79016171 CTCCATCTATAATCTGTGCCTGG - Intergenic
934312742 2:91883956-91883978 CTGAATACCTACTCTGTGCCAGG - Intergenic
935426006 2:102918867-102918889 CTGAATGTCTCCTCTGTGCCAGG - Intergenic
935844237 2:107147331-107147353 CTGAATGTGTACTGTGTGCCAGG + Intergenic
936103920 2:109608189-109608211 CTGCATATATACTATTTGGCAGG - Intronic
936400974 2:112164216-112164238 TTGCATCTTTACTATGTGCCAGG - Intronic
936896349 2:117432305-117432327 TTGAATATTTACTATGTGCCAGG + Intergenic
936917787 2:117657544-117657566 CTGAATATTTACTGTGTGCTAGG - Intergenic
936994872 2:118402893-118402915 CTGCAGAAGTGCTCTGTGCCTGG + Intergenic
937037631 2:118794952-118794974 CTGAACATTTACTCTGTGCCTGG + Intergenic
937047680 2:118860604-118860626 GTGCATATGGACTCAGTGCTGGG - Intergenic
938565067 2:132511715-132511737 CTTAATATGTACTACGTGCCAGG + Intronic
939992184 2:148886245-148886267 CTGCATCTGCCCTCTGTGACAGG + Intronic
941107336 2:161370801-161370823 TTAAAAATGTACTCTGTGCCTGG + Intronic
941463989 2:165803364-165803386 CTGAGTATTAACTCTGTGCCAGG + Intergenic
941585062 2:167348138-167348160 CTGAATATGTGTTATGTGCCAGG - Intergenic
942720305 2:178944286-178944308 CTGAATAGTTACTATGTGCCAGG - Intronic
942731851 2:179069120-179069142 TTAAATATGTACTCAGTGCCAGG + Intergenic
943670832 2:190658752-190658774 CTGAATACTTACTTTGTGCCAGG - Intronic
943889594 2:193270152-193270174 CTGGATATATACTATTTGCCAGG - Intergenic
944002442 2:194855904-194855926 CTGAATACGTACTGTGTACCAGG + Intergenic
944396657 2:199275396-199275418 CTGAATGTTTATTCTGTGCCAGG + Intronic
945062839 2:205923983-205924005 CTGAGCATGTACTGTGTGCCAGG + Intergenic
945644045 2:212467376-212467398 CAGCATAGGGACTCTGGGCCTGG - Intronic
946187091 2:217987287-217987309 CTGCATATGAACCCTGTCCTGGG - Intronic
946282331 2:218674990-218675012 TTGAATATTTACTATGTGCCAGG + Intronic
946952788 2:224895559-224895581 CTGCACACCTACTATGTGCCAGG + Intronic
946984303 2:225254969-225254991 CTGAATATCTACTATGTGCAGGG - Intergenic
947157173 2:227174460-227174482 CTGGATATGCATTCTGTACCAGG - Intronic
947163872 2:227241761-227241783 CTGCATATGTACTCTGTGCCAGG + Intronic
947221446 2:227796641-227796663 CGGCATGTGTTCTTTGTGCCAGG + Intergenic
947336470 2:229090812-229090834 TTGAACATGTACTATGTGCCAGG + Intronic
947375624 2:229492148-229492170 CTGAATGTGTACTATGTGCCAGG - Intronic
948602909 2:239117397-239117419 CTCCATATGCAGTCTGTCCCTGG - Intronic
1169353631 20:4890145-4890167 GAGCATATATACTCTGTGCCTGG + Intronic
1169390211 20:5184665-5184687 TTGAATATGTACTCTGTGCTAGG + Intronic
1169815945 20:9656230-9656252 CTGCTCATCTACTATGTGCCAGG - Intronic
1169860069 20:10141807-10141829 CAGCATTTGTACTCTGAGCATGG + Intergenic
1170202077 20:13755139-13755161 CTGAATACCTACTCTGTGCCGGG - Intronic
1171564586 20:26168979-26169001 CTGCATATGTAAACTGTTTCAGG - Intergenic
1172116790 20:32577797-32577819 CTGCCTACCTACTCTATGCCGGG + Intronic
1172532697 20:35644138-35644160 CTGGGTACTTACTCTGTGCCGGG - Intronic
1172803224 20:37592887-37592909 CTGAGAATTTACTCTGTGCCAGG + Intergenic
1173338354 20:42131649-42131671 CTGCACACCTACTATGTGCCAGG + Intronic
1173697802 20:45035890-45035912 TTGAAAATGTACTATGTGCCAGG + Intronic
1173862443 20:46293040-46293062 CTGAGCATCTACTCTGTGCCAGG - Intronic
1174231879 20:49052230-49052252 CTAAATATGTACTGTGTGCCAGG + Intronic
1174321390 20:49744404-49744426 TTGAACATTTACTCTGTGCCAGG - Intergenic
1174350585 20:49964789-49964811 CTGAACATCTGCTCTGTGCCAGG + Intergenic
1174505015 20:51011762-51011784 CTGAATACCTACTATGTGCCAGG - Intronic
1174558119 20:51411036-51411058 CTGGGTATTTACTCTGTGCCAGG + Intronic
1174622901 20:51890223-51890245 CTGAGCATGTACTGTGTGCCAGG - Intergenic
1174731457 20:52922163-52922185 TTGCATATGTGCTGTGTGCCAGG + Intergenic
1174747161 20:53074736-53074758 AGGCACATCTACTCTGTGCCAGG + Intronic
1175617214 20:60410802-60410824 CTGTGTGTTTACTCTGTGCCAGG + Intergenic
1178350244 21:31867751-31867773 CTGCACATGTACAGTGTACCAGG + Intergenic
1178906493 21:36641382-36641404 TTGAACATTTACTCTGTGCCTGG - Intergenic
1179492390 21:41749542-41749564 CTGCGCAGGTGCTCTGTGCCTGG - Intronic
1180197949 21:46208617-46208639 CTGCGGGTGTGCTCTGTGCCAGG + Intronic
1180539484 22:16429805-16429827 CTGAATATCTACTCTGTGCCAGG - Intergenic
1180821277 22:18829720-18829742 CTTAATATTTACTCTATGCCAGG + Intergenic
1181191701 22:21146325-21146347 CTTAATATTTACTCTATGCCAGG - Intergenic
1181207496 22:21264185-21264207 CTTAATATTTACTCTATGCCAGG + Intergenic
1181365249 22:22371516-22371538 CTGAATACCTACTATGTGCCAGG + Intergenic
1181726834 22:24817223-24817245 CTGGGGATGTACTATGTGCCAGG + Intronic
1181947329 22:26528381-26528403 CTGTACATCTACTATGTGCCAGG + Intronic
1181960951 22:26621539-26621561 CTGAATGTTTACTCTGTACCAGG + Intergenic
1182060577 22:27394285-27394307 CTGAACATTTACTATGTGCCTGG - Intergenic
1182208722 22:28655152-28655174 GAGCACATGTGCTCTGTGCCAGG + Intronic
1182697075 22:32205059-32205081 CTGCGTAGCTGCTCTGTGCCCGG + Intergenic
1182756178 22:32681407-32681429 CTGGATATTTACCTTGTGCCTGG + Intronic
1182785066 22:32900457-32900479 TTGAATAAATACTCTGTGCCAGG + Intronic
1183008817 22:34927893-34927915 TTGAATATTTAGTCTGTGCCAGG - Intergenic
1183027002 22:35072723-35072745 CTGAATATCTACTGCGTGCCAGG + Intronic
1183752118 22:39727300-39727322 CTGCACACCTGCTCTGTGCCAGG - Intergenic
1183793534 22:40095785-40095807 CTGAATACCTACTCTGTGCCAGG + Intronic
1203219423 22_KI270731v1_random:31231-31253 CTTAATATTTACTCTATGCCAGG - Intergenic
1203271402 22_KI270734v1_random:55596-55618 CTTAATATTTACTCTATGCCAGG + Intergenic
949273325 3:2247046-2247068 ATGCATATGTGCTTTGTGCATGG - Intronic
949493975 3:4614415-4614437 TTGAATGTTTACTCTGTGCCAGG + Intronic
950218489 3:11176687-11176709 CTGCACATCTCCTCTCTGCCAGG + Intronic
950580632 3:13859689-13859711 CTGGGTACCTACTCTGTGCCAGG - Intronic
952054381 3:29426855-29426877 CTGAATATTGGCTCTGTGCCAGG + Intronic
952911291 3:38189695-38189717 TTGAAGGTGTACTCTGTGCCAGG + Intronic
953596046 3:44315067-44315089 CTAAATATTTACTCTGTGCCAGG - Intronic
953962933 3:47281090-47281112 CTGAATACCTACTCTGTGCTGGG - Intronic
954039195 3:47871379-47871401 CTGAATATCTACTTTGAGCCAGG + Intronic
954674509 3:52308448-52308470 CTGAACATCTCCTCTGTGCCAGG + Intergenic
955004063 3:54953138-54953160 CTGAATATTTACTATGTGCCTGG + Intronic
955697946 3:61655436-61655458 CTGAACATCTACTATGTGCCAGG - Intronic
956305997 3:67826120-67826142 CTAAATATGTACTCTAAGCCAGG - Intergenic
956335321 3:68156753-68156775 CTGAGTATGTGTTCTGTGCCAGG + Intronic
957226077 3:77448634-77448656 CTTAATATATACTCTGTGCCAGG - Intronic
957573181 3:81975329-81975351 CTGTGTATCCACTCTGTGCCAGG + Intergenic
959277372 3:104293639-104293661 TTGAATATTTACTCTTTGCCAGG - Intergenic
960452719 3:117830105-117830127 TTGCATACCTACTCTGTCCCAGG - Intergenic
960786245 3:121375064-121375086 CTGAATAAGTACTCTGTACCTGG - Intronic
961071523 3:123933407-123933429 CTGAATACCTACTGTGTGCCAGG - Intronic
961434680 3:126908758-126908780 TTGAATATTTACTCTGTGCCAGG + Intronic
962445010 3:135456272-135456294 CTGCAGAGGCACTCTGGGCCTGG + Intergenic
962629185 3:137258724-137258746 CTGAATATCTATTATGTGCCAGG - Intergenic
962951988 3:140227905-140227927 CAGCATAGGTACCCTGGGCCTGG + Intronic
964675171 3:159270090-159270112 CTGAATGTCTACTGTGTGCCAGG + Intronic
965454462 3:168880381-168880403 CTGAATACCTACTGTGTGCCAGG - Intergenic
965533262 3:169798164-169798186 CTGAGTTTGTCCTCTGTGCCTGG - Intronic
966996834 3:185290778-185290800 CTGAATCTATACTTTGTGCCAGG - Intronic
967589058 3:191250800-191250822 CTGAAAATTTACTCTGTTCCAGG + Intronic
967800276 3:193650745-193650767 CAGCATTTTTACGCTGTGCCTGG + Intronic
967811840 3:193767123-193767145 CTGCATTTTTTCTGTGTGCCAGG - Intergenic
967861470 3:194155237-194155259 CTGTATACCTACTATGTGCCAGG + Intergenic
968691186 4:1991172-1991194 CTGAGCATGTACTCTGGGCCAGG + Intronic
968850998 4:3078248-3078270 CTAAACATGTACTATGTGCCTGG + Intronic
969253464 4:5986891-5986913 CTGCCTATCTACTATGTGCCAGG - Intronic
970038865 4:11772981-11773003 CTGCATATGTACTCTAGGGCAGG - Intergenic
970352215 4:15213906-15213928 CTGAGTATAAACTCTGTGCCAGG + Intergenic
970564767 4:17321060-17321082 CTGAATATACATTCTGTGCCGGG + Intergenic
970793360 4:19886347-19886369 CTGCATATTTACTCTTATCCTGG - Intergenic
971132881 4:23833029-23833051 TTGAACATCTACTCTGTGCCAGG + Intronic
971986561 4:33832595-33832617 CTGCATATGTAAACTGTTTCAGG + Intergenic
972294306 4:37721937-37721959 CTGCACATTTACTATATGCCAGG - Intergenic
972629137 4:40828508-40828530 CTGCATACTTATTCTGTGCCAGG + Intronic
972713243 4:41619638-41619660 CTGAATACCTACTGTGTGCCAGG - Intronic
975128263 4:70806384-70806406 CTGAATGTTTACTATGTGCCAGG - Intronic
975582736 4:75921466-75921488 TTGAATATCTACACTGTGCCAGG + Intronic
977373997 4:96177157-96177179 CTGAATATTTACATTGTGCCAGG + Intergenic
978332801 4:107633334-107633356 TTGTATATTTACTGTGTGCCAGG - Intronic
978477905 4:109153088-109153110 CTACAAAAGTACTCTGGGCCGGG + Intronic
979284226 4:118903340-118903362 CTGCATGATTACTGTGTGCCAGG - Intronic
979571873 4:122236917-122236939 CTGCATCTGTACTCCATTCCTGG - Intronic
979928370 4:126596532-126596554 CTGGACTTGTACTCTGTGCAAGG - Intergenic
980353986 4:131721677-131721699 CAGCACTTGTACTGTGTGCCTGG - Intergenic
980974168 4:139595165-139595187 TTGAATATTTACTATGTGCCAGG - Intronic
981660711 4:147163418-147163440 CTGAGTATCTACTGTGTGCCAGG + Intergenic
982188726 4:152831258-152831280 CTGAATATCTGCTCTGTACCAGG + Intronic
982209593 4:153023617-153023639 GAGCATATGTGCTCTGTGGCAGG - Intergenic
982827761 4:160021955-160021977 CTACCTATACACTCTGTGCCAGG - Intergenic
983326577 4:166265421-166265443 CAGTATTTGTATTCTGTGCCTGG + Intergenic
983518117 4:168678329-168678351 TTGCATATGTCCTATGTGCCCGG - Intronic
983910230 4:173230708-173230730 CTGGATAAGTACTCTGTGAGGGG + Intronic
985226482 4:187766661-187766683 ATGCATATGTATTGTGTGCATGG - Intergenic
987713098 5:21529586-21529608 CTGAATATCTACTCTGTGCCAGG - Intergenic
988389217 5:30605812-30605834 GTCAATATTTACTCTGTGCCTGG + Intergenic
988884909 5:35546065-35546087 TTGCATTTCTCCTCTGTGCCAGG - Intergenic
989182292 5:38590439-38590461 CTGCCTCTGTTGTCTGTGCCTGG + Intronic
990480066 5:56201693-56201715 TTGAATATTTACTCTGGGCCAGG - Intronic
992319961 5:75604021-75604043 CTCCGTATCTACTGTGTGCCAGG - Intergenic
993944855 5:94106069-94106091 CTTCATATGAAATCTTTGCCAGG - Intronic
994707318 5:103222661-103222683 CTGCTTATTAACTATGTGCCTGG + Intergenic
995519586 5:112989042-112989064 CTTCATGGTTACTCTGTGCCAGG + Intronic
995872920 5:116761376-116761398 CAGAATATTTACTATGTGCCAGG + Intergenic
997468871 5:134105561-134105583 CTGGATATCTGCTCTCTGCCAGG + Intergenic
997719965 5:136070403-136070425 TTGAATACGTACTGTGTGCCAGG - Intergenic
997816783 5:137026954-137026976 CTGAATGACTACTCTGTGCCAGG - Intronic
997838049 5:137212501-137212523 CTGAATATGTACTATGTGTCAGG + Intronic
998367868 5:141642673-141642695 CTGCATACTTACTGTGTGCCAGG + Intronic
998985206 5:147749263-147749285 TTGAATATTTACTATGTGCCAGG + Intronic
999076374 5:148799651-148799673 CTGCATATCTGCTATTTGCCAGG - Intergenic
999270665 5:150294775-150294797 CTGGGTCTGGACTCTGTGCCAGG - Intergenic
999401350 5:151266779-151266801 CTGCCAATGTAGTCTGTGCATGG - Exonic
999638623 5:153648597-153648619 CTGAAAATGTACTGTGTGTCTGG - Intronic
1000163876 5:158628250-158628272 CTGAACATTTACTGTGTGCCAGG - Intergenic
1000280169 5:159775131-159775153 CTGAGTATTTACTGTGTGCCAGG + Intergenic
1000934874 5:167295440-167295462 GTGCATATGTGATCTGTGCAGGG + Intronic
1000946543 5:167429379-167429401 CTGCACATCTCCTCTGTGCCAGG + Intronic
1001279438 5:170376063-170376085 GTGCTTATTTATTCTGTGCCAGG - Exonic
1001438476 5:171719490-171719512 CTGCATTTGCACTCTGGGCTGGG + Intergenic
1002457261 5:179352469-179352491 CTGCACACCTACTATGTGCCAGG - Intergenic
1004182898 6:13396293-13396315 TAGCATATTTAATCTGTGCCAGG + Intronic
1004276040 6:14235988-14236010 CTGGATCTGTTCTCTCTGCCTGG - Intergenic
1004472867 6:15944682-15944704 CATAATATTTACTCTGTGCCAGG + Intergenic
1005432128 6:25769287-25769309 CTGAACATGTACTATGTGCCAGG + Intronic
1005466071 6:26115240-26115262 CTGGATGTTTGCTCTGTGCCAGG + Intronic
1005763207 6:28986550-28986572 CTGAATGCCTACTCTGTGCCTGG - Intergenic
1006662052 6:35655251-35655273 CTGAATACCTACTATGTGCCAGG + Intronic
1006725047 6:36193278-36193300 CTGCATATTTTCCCTTTGCCTGG + Intergenic
1006904914 6:37526727-37526749 CTGCATACCTACTGTGTGCCAGG - Intergenic
1007452933 6:41953891-41953913 CTGAATACTTACTATGTGCCAGG + Intronic
1007663305 6:43499579-43499601 TTGAATATGTACTCCCTGCCAGG + Intronic
1007904895 6:45449684-45449706 CTGCATGCCCACTCTGTGCCAGG - Intronic
1008071137 6:47100311-47100333 CTTCCTTTGTTCTCTGTGCCTGG + Intergenic
1008151109 6:47952431-47952453 CTGAGTATATACTTTGTGCCAGG - Intronic
1008434167 6:51455835-51455857 TTGCATGTGTACTATGTTCCAGG + Intergenic
1008878058 6:56351030-56351052 CTTCATGCCTACTCTGTGCCCGG + Intronic
1009003621 6:57752329-57752351 CTGAATATCTACTCTGTGCCAGG + Intergenic
1009438034 6:63640517-63640539 CTGGATATTTACTGTGTGCAAGG - Intronic
1009459394 6:63894143-63894165 CTCCAAATGCACCCTGTGCCAGG - Intronic
1009467934 6:63996218-63996240 CAGTATTTGTACTCTGTGGCTGG - Intronic
1010249600 6:73694266-73694288 TTGAATAGCTACTCTGTGCCAGG + Intergenic
1011516229 6:88156716-88156738 TTGAATACCTACTCTGTGCCAGG - Intronic
1012652715 6:101777012-101777034 CTGCCTATGCACCATGTGCCAGG + Intronic
1012812491 6:103978073-103978095 TTGAATATTTTCTCTGTGCCAGG + Intergenic
1012999522 6:106008545-106008567 CTGAATATTTACTAAGTGCCTGG + Intergenic
1013419412 6:109952434-109952456 CTGCATGCTTACTATGTGCCAGG - Intergenic
1013520318 6:110926817-110926839 ATGAATATTTACTATGTGCCAGG - Intergenic
1014641274 6:123913934-123913956 CTTAATATTTACTATGTGCCTGG + Intronic
1014652656 6:124059583-124059605 CTGAATATCCACTCTGTGCCAGG - Intronic
1014797138 6:125738548-125738570 CTGCATGTGTACAATGTACCAGG - Intergenic
1015690032 6:135911667-135911689 CTGCATAGGTTCACAGTGCCTGG - Intronic
1015704887 6:136077024-136077046 CTTCTTATGTACCCTGTGCCAGG + Intronic
1017082063 6:150679653-150679675 TTGAGTATGTACTCTGTGCCAGG + Intronic
1017774918 6:157673075-157673097 CTGCATGAGGACTCTGTGCGCGG + Exonic
1019102413 6:169641898-169641920 CTGAGAATCTACTCTGTGCCAGG + Intronic
1020293472 7:6740509-6740531 CTACATATGTACTTTTTGACGGG - Intergenic
1020878291 7:13726605-13726627 CTGAATATTTACTCTATGGCAGG + Intergenic
1021640404 7:22730657-22730679 CTAAATATGAACTATGTGCCAGG + Intronic
1021914356 7:25416582-25416604 CTGAGCATCTACTCTGTGCCAGG - Intergenic
1021965053 7:25909358-25909380 CTCCATGTGTGCTCTGTGCTGGG - Intergenic
1022243917 7:28539221-28539243 CTGAGTATTTACTATGTGCCAGG - Intronic
1022596946 7:31721855-31721877 CTGAATATCTACCCTGTACCAGG + Intergenic
1022823374 7:33983485-33983507 CTGAATGTGTACCCTGTGCCAGG + Intronic
1022873600 7:34504946-34504968 CAGCACCTGTACTCTGTGCCTGG + Intergenic
1023491786 7:40750884-40750906 CTGAGTATATACTATGTGCCAGG + Intronic
1024496092 7:50047448-50047470 TTGTATATGTACTCTGTGTCTGG - Intronic
1024521245 7:50305590-50305612 CTGCATTTGAAAGCTGTGCCTGG - Intronic
1025273198 7:57545549-57545571 CTGCATATGTAAACTGTTTCAGG + Intergenic
1027362809 7:77427100-77427122 CTGCATATGAACTTGGTGACAGG - Intergenic
1027803105 7:82781341-82781363 CTGCACATGTACTCTGTTTTGGG - Intronic
1028003502 7:85531779-85531801 CTTCATATGTACTCTGTGAAAGG - Intergenic
1028005958 7:85567581-85567603 CTGCCTATGTAATTTTTGCCAGG + Intergenic
1028447062 7:90936753-90936775 ATGCATATGCACGCTGTGTCTGG + Intronic
1029012855 7:97281101-97281123 TTGAATATCTATTCTGTGCCTGG + Intergenic
1030492054 7:110249608-110249630 CTTCATATTTACTCTATGCAGGG - Intergenic
1030932060 7:115536744-115536766 CTGAATGATTACTCTGTGCCAGG - Intergenic
1031402941 7:121346821-121346843 CTGAATGAGTACTTTGTGCCAGG + Intergenic
1031542471 7:123011122-123011144 CTGCATTTATACTATGTGGCAGG + Intergenic
1031557744 7:123198886-123198908 CTGCACACTTACTGTGTGCCAGG + Intronic
1031656350 7:124360831-124360853 CTGCATATCTTCTCTGTGGCCGG + Intergenic
1031842268 7:126758235-126758257 TTGCATATTTACACTGTGCCAGG + Intronic
1032728413 7:134613764-134613786 TTGAATATCTACTCTGTGCCAGG - Intergenic
1032753194 7:134863287-134863309 TTGAATATGTACTATGTGGCAGG - Intronic
1032872340 7:135999706-135999728 TTAAGTATGTACTCTGTGCCAGG + Intergenic
1032940405 7:136782139-136782161 GTGAGTATGTACTCTGTGTCAGG - Intergenic
1033445365 7:141416820-141416842 CTCGTTATGTACTCTGTGTCTGG - Intronic
1034100041 7:148443222-148443244 CTGGAAATGTATTGTGTGCCAGG - Intergenic
1034901547 7:154910770-154910792 AGGCATCTGTAATCTGTGCCAGG - Intergenic
1035947873 8:3985271-3985293 CTGCAAATGTGCTTTGTGCATGG - Intronic
1036776533 8:11616790-11616812 CTGCATGCCTACTATGTGCCAGG + Intergenic
1037603492 8:20418570-20418592 CTGCACATGTAGTAAGTGCCAGG - Intergenic
1037794551 8:21981069-21981091 TTGAATACCTACTCTGTGCCAGG + Intronic
1038050113 8:23801022-23801044 CTACATATCTAGTATGTGCCTGG - Intergenic
1038342468 8:26698055-26698077 CTGCACCTGTGCTCTCTGCCTGG + Intergenic
1038465684 8:27760571-27760593 CTGAATACCTACTATGTGCCAGG + Intronic
1038560558 8:28575416-28575438 CTGATTATCTACTATGTGCCAGG + Intergenic
1039031357 8:33313019-33313041 CTGAGTACATACTCTGTGCCAGG + Intergenic
1040046888 8:42973900-42973922 CTGAATATCTACTATGTGCAGGG - Intronic
1041559363 8:59197214-59197236 TTGAGCATGTACTCTGTGCCAGG - Intergenic
1042648972 8:71018627-71018649 CTGAGTACGTACTATGTGCCAGG - Intergenic
1043512709 8:80965459-80965481 CTGAGTATTTACTATGTGCCAGG - Intergenic
1043667399 8:82833426-82833448 CTGAATACCTACTATGTGCCAGG - Intergenic
1043793937 8:84511373-84511395 TTGAAAATGTACTATGTGCCAGG - Intronic
1044255201 8:90052009-90052031 TTGAATATGTATTATGTGCCAGG + Intronic
1045050847 8:98323655-98323677 CTGCATTTGTACCGTATGCCAGG + Intergenic
1046016212 8:108608491-108608513 TTGCATATTTAATATGTGCCAGG - Intronic
1047123256 8:121930314-121930336 CTGAGTATTTACTCTATGCCAGG - Intergenic
1047395235 8:124491612-124491634 ATGAATAGGTACACTGTGCCTGG - Intronic
1047428926 8:124773915-124773937 TTGCATATTTACTGTGTGCAAGG + Intergenic
1047745417 8:127841158-127841180 CTGAACAGGTACTATGTGCCAGG - Intergenic
1047964746 8:130038364-130038386 CTGTGTATATACTATGTGCCAGG - Intergenic
1047985554 8:130229612-130229634 TTGAATACCTACTCTGTGCCAGG - Intronic
1048593327 8:135841856-135841878 TTGCATACTTACTATGTGCCAGG - Intergenic
1048970460 8:139642614-139642636 CTGCATCTGTGCTCTTTGCCTGG - Intronic
1049231615 8:141487838-141487860 TTGCGTATGTGCTCTGTGCCAGG + Intergenic
1050057221 9:1668219-1668241 CTGAGTATCTACTCTGTGTCAGG - Intergenic
1050190597 9:3021303-3021325 TTGCATACTTACTATGTGCCAGG - Intergenic
1051788757 9:20775699-20775721 CAGCATATGTCCTTAGTGCCTGG + Intronic
1052279493 9:26716682-26716704 CTGCGTGTCTACTATGTGCCAGG - Intergenic
1052854032 9:33395899-33395921 TTGCACATCTACTATGTGCCTGG - Intronic
1053103740 9:35393057-35393079 TTGAATATTTTCTCTGTGCCTGG + Intronic
1053682046 9:40492063-40492085 TTGCACATCTACTATGTGCCTGG - Intergenic
1053932034 9:43120389-43120411 TTGCACATCTACTATGTGCCTGG - Intergenic
1054281667 9:63132869-63132891 TTGCACATCTACTATGTGCCTGG + Intergenic
1054295143 9:63327560-63327582 TTGCACATCTACTATGTGCCTGG - Intergenic
1054393163 9:64632066-64632088 TTGCACATCTACTATGTGCCTGG - Intergenic
1054427812 9:65137276-65137298 TTGCACATCTACTATGTGCCTGG - Intergenic
1054502564 9:65884262-65884284 TTGCACATCTACTATGTGCCTGG + Intronic
1054724937 9:68640847-68640869 CTGCCTCCTTACTCTGTGCCAGG + Intergenic
1055746386 9:79450064-79450086 CTTCATATGTGGTCTGTGCATGG - Intergenic
1055835233 9:80432011-80432033 GTGCATTTGGCCTCTGTGCCTGG + Intergenic
1056259855 9:84837051-84837073 CTGAATGCCTACTCTGTGCCAGG - Intronic
1056505547 9:87254854-87254876 GTGAATGTTTACTCTGTGCCAGG + Intergenic
1056803629 9:89711472-89711494 CTGCACACCTACTCTGTGCCCGG - Intergenic
1057125381 9:92612114-92612136 AAGCTTATGTACTGTGTGCCAGG - Intronic
1057822002 9:98339710-98339732 TTGAGTATGTACTATGTGCCAGG + Intronic
1057846172 9:98526382-98526404 GTGCATCTGTTCTCTCTGCCTGG + Intronic
1058105486 9:100965934-100965956 TTACATATTTACTCTGTTCCAGG + Intergenic
1058657597 9:107237817-107237839 TTGGGTTTGTACTCTGTGCCAGG - Intergenic
1058785016 9:108378421-108378443 TTGCATATGTACTGTGTTCCAGG - Intergenic
1059019201 9:110555272-110555294 ATGAACATGTACTCTGTGCCCGG - Intronic
1059395931 9:114034105-114034127 CTGAGTATGTAATCTGTGCCAGG - Intronic
1059553055 9:115249917-115249939 CTGCACATGTACCGTGTTCCAGG + Intronic
1059738357 9:117124828-117124850 CTGCATGTGGCATCTGTGCCAGG + Intronic
1060133155 9:121124984-121125006 CTGGATACGCACTATGTGCCAGG - Intronic
1060342166 9:122787330-122787352 TTGCATTTGTCCTCTTTGCCTGG - Intergenic
1060448291 9:123712546-123712568 TGGCATGTTTACTCTGTGCCAGG - Intronic
1060695793 9:125707710-125707732 CTGCATGTTTACTATGTGTCAGG - Intergenic
1060855715 9:126914192-126914214 CCACATCTTTACTCTGTGCCAGG - Intergenic
1060901605 9:127262785-127262807 CTGCATGTCCACTATGTGCCAGG + Intronic
1060948997 9:127588789-127588811 CTGCATGCCTACTATGTGCCAGG - Intergenic
1186184927 X:7011381-7011403 CAGCATTTGTACACTGTGTCTGG + Intergenic
1186949784 X:14611284-14611306 GTGCATGTGTACTCTGTACGGGG - Intronic
1187997590 X:24945209-24945231 CTGCATGCTTACTATGTGCCAGG - Intronic
1188636215 X:32435406-32435428 TTGAATATGTACTGTGTTCCTGG + Intronic
1188707606 X:33355294-33355316 CTGCATCTTTCCCCTGTGCCAGG + Intergenic
1188749019 X:33883029-33883051 TTGAATATGTACTATGTGTCAGG - Intergenic
1188882812 X:35510978-35511000 CTGAATGTGTACTATGTTCCAGG - Intergenic
1189075371 X:37908794-37908816 CTGAATATTTACTCTTTTCCAGG - Intronic
1189901759 X:45713674-45713696 TTGGATATTTACTATGTGCCAGG - Intergenic
1190058876 X:47198287-47198309 CTGCCTACCTACTCTGTGCCAGG + Intronic
1191035061 X:56016272-56016294 CTGAATACTCACTCTGTGCCAGG - Intergenic
1191976214 X:66874385-66874407 CTGAATACCTACTCTGTGTCAGG - Intergenic
1192616772 X:72632883-72632905 CTGAATACTTTCTCTGTGCCAGG - Intronic
1194616931 X:96115870-96115892 ATTGATATCTACTCTGTGCCAGG - Intergenic
1194775227 X:97954935-97954957 TTGAATATTTACTATGTGCCAGG + Intergenic
1194842332 X:98758720-98758742 CTGTATATGTATTCTTAGCCAGG + Intergenic
1195053484 X:101120809-101120831 CTGCCAATGTACTATGTGCCAGG + Intronic
1195389132 X:104342784-104342806 TTGCATCTGTCCACTGTGCCTGG - Intergenic
1195432562 X:104805731-104805753 CTGCATACTTACTATGTGCTAGG + Intronic
1195451104 X:105013988-105014010 CTGAATACGCACTATGTGCCTGG - Intronic
1195704339 X:107728120-107728142 CTGCATTTGTACTGTGTGCCAGG - Intronic
1195741088 X:108065107-108065129 CTGTAAATGTACTCTTTTCCTGG + Intronic
1196047946 X:111275672-111275694 CTGCACATTTACTTGGTGCCTGG - Intergenic
1197138885 X:123094789-123094811 CTGAATACCTTCTCTGTGCCAGG - Intergenic
1198632406 X:138655175-138655197 CTGCAACAGTAATCTGTGCCTGG + Intronic
1198667416 X:139039835-139039857 CTGCAGGTGTTCTCTTTGCCTGG - Intronic
1198670726 X:139077526-139077548 CTGGATATTTATGCTGTGCCTGG - Intronic
1198977818 X:142356931-142356953 CTGAGAATCTACTCTGTGCCAGG + Intergenic
1199002066 X:142650748-142650770 CTGCAGGTGTGCTCTGTGCCTGG + Intergenic
1199050351 X:143229725-143229747 CAGCATTTGCATTCTGTGCCTGG + Intergenic
1199296444 X:146164284-146164306 TTGAATATTTTCTCTGTGCCAGG - Intergenic
1199431517 X:147766153-147766175 CTGAATATCTACTATGTGCCTGG + Intergenic
1200051294 X:153433245-153433267 CTGCACATGTGCTATGTGCCAGG + Intergenic
1200335420 X:155346313-155346335 CTACGTATGAACTCTGTGGCAGG + Intergenic
1200351048 X:155494908-155494930 CTACGTATGAACTCTGTGGCAGG - Intronic
1201180687 Y:11341443-11341465 CTGAATACCTACTCTGTGCCAGG - Intergenic