ID: 947166473

View in Genome Browser
Species Human (GRCh38)
Location 2:227267454-227267476
Sequence ATGAAAAAATGGACTGAGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 633
Summary {0: 1, 1: 0, 2: 1, 3: 40, 4: 591}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947166473_947166477 12 Left 947166473 2:227267454-227267476 CCCTACTCAGTCCATTTTTTCAT 0: 1
1: 0
2: 1
3: 40
4: 591
Right 947166477 2:227267489-227267511 AAAAGAGTCATAGAAAAATGTGG 0: 1
1: 0
2: 5
3: 63
4: 794

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947166473 Original CRISPR ATGAAAAAATGGACTGAGTA GGG (reversed) Intronic
900805290 1:4763589-4763611 GTGAAATAATGGACTGAGTCTGG + Intronic
901253927 1:7804696-7804718 ATTAAAAAATGGACACAGTCCGG - Intronic
901280523 1:8030574-8030596 ATGGAAAAATGGGCTGGGCATGG - Intergenic
903730431 1:25490178-25490200 ATGAAAAAATTGATTGGGGAAGG + Intronic
903984407 1:27215270-27215292 ACAAAAAAATTGGCTGAGTATGG + Intergenic
904100038 1:28018037-28018059 ATATAAAAATGAACTGGGTATGG + Intronic
904202454 1:28829863-28829885 ATTAAAAAATTAGCTGAGTATGG - Intronic
904409924 1:30319240-30319262 GTGAATAAATGCACTGAGGAAGG + Intergenic
904633329 1:31860102-31860124 TTGAACCAGTGGACTGAGTAAGG - Intergenic
905816862 1:40957984-40958006 AAGAAAAAATGGTCTGGGTGTGG + Intergenic
906004071 1:42454194-42454216 AAGAAAAAATGGGGTGAGTGTGG + Intronic
906579701 1:46926426-46926448 ATGAAATATTGGACAGAATATGG - Intergenic
906740053 1:48173683-48173705 ATGAAATAATGGAATGAAGATGG - Intergenic
906923801 1:50092601-50092623 ATGAAAACATGGGCAGAATAAGG - Intronic
907380262 1:54081382-54081404 ATAAAAGAATTGACTGGGTATGG - Intronic
907450639 1:54543567-54543589 ATGAGAAAATGCACCGAGAAAGG + Intronic
907789326 1:57646591-57646613 ATGAAAAAATTAGCTGGGTATGG + Intronic
907844124 1:58188197-58188219 ATGCAAAAACTGGCTGAGTATGG - Intronic
908515235 1:64885461-64885483 ATGAAAAAATCGGCTGGGTGTGG + Intronic
908734173 1:67258358-67258380 ATGAGAAAATGGAGGGAGAAAGG + Intronic
909418453 1:75434397-75434419 ATGAAAAAATGGGTTGGGAACGG - Intronic
909604284 1:77493164-77493186 TTGAATCAGTGGACTGAGTAAGG + Intronic
910082786 1:83361250-83361272 ATGAAAATATAGAATGAGTAAGG + Intergenic
910393659 1:86770026-86770048 TTGAATCAGTGGACTGAGTAAGG - Intergenic
910504096 1:87929458-87929480 ATGAAAATATTACCTGAGTAAGG + Intergenic
910579495 1:88807006-88807028 ATGAAAAACTGGGCTGAGCACGG - Intronic
910675530 1:89812640-89812662 TTGAATCAGTGGACTGAGTAAGG - Intronic
910881046 1:91922648-91922670 ATGAAAAAATTAGCTGAGCATGG - Intergenic
912622220 1:111173283-111173305 AAAAAAAAATGGACTGAATTAGG - Intronic
913678675 1:121167125-121167147 AAGAACCAATGGAATGAGTATGG - Intergenic
914030508 1:143954769-143954791 AAGAACCAATGGAATGAGTATGG - Intronic
914158941 1:145113192-145113214 AAGAACCAATGGAATGAGTATGG + Intergenic
915756913 1:158270482-158270504 ATGCAAAAATGAACTGAAGATGG + Intergenic
916849368 1:168687430-168687452 ATGAAAAAATGGAATATGTGTGG + Intergenic
917184245 1:172334989-172335011 ATACAAAAATAGACTCAGTAAGG + Intronic
917466111 1:175277682-175277704 ATAAAAGAATAGACAGAGTAGGG - Intergenic
917502897 1:175601918-175601940 ATGAATAAATGCACACAGTAAGG + Intronic
917995550 1:180434970-180434992 AAGTACAGATGGACTGAGTACGG + Intronic
918341068 1:183568320-183568342 ATGAAAAAATTAGCTGAGTGTGG - Intronic
918713041 1:187755530-187755552 TTGAATCAGTGGACTGAGTAAGG + Intergenic
919248835 1:195026836-195026858 ATTAAAAAATGAAATGATTAGGG + Intergenic
919629848 1:199949766-199949788 ATGAAAAAATTAGCTGGGTACGG + Intergenic
920465973 1:206185661-206185683 AAGAACCAATGGAATGAGTATGG - Intergenic
921292947 1:213675719-213675741 ATGCAAAAATTAGCTGAGTATGG + Intergenic
921304995 1:213787412-213787434 ATGAAAAGATGGAGTGAGCCAGG + Intergenic
921807621 1:219474065-219474087 ATTCCAAAATGGAATGAGTATGG + Intergenic
921835543 1:219774502-219774524 ATGAGAAAGTGAACTGACTAGGG + Intronic
922756218 1:228098405-228098427 TTTAAAAAATGCACTGAGTTTGG - Exonic
923004794 1:230039401-230039423 ATGAAAAAATTAACTGGGTGTGG - Intergenic
923004815 1:230039538-230039560 AAGAAAAACTAGGCTGAGTATGG - Intergenic
924116281 1:240751218-240751240 TTGAATCAGTGGACTGAGTAAGG + Intergenic
924838427 1:247679576-247679598 ATAAAATCATGGCCTGAGTAGGG - Intergenic
1064667862 10:17675346-17675368 ATAAAAAAATCAGCTGAGTATGG + Intronic
1065511772 10:26486402-26486424 ATGGAAAAATGGGAGGAGTAAGG + Intronic
1065550154 10:26861414-26861436 ATTAAAAAGGGGACAGAGTACGG + Intergenic
1066054531 10:31668104-31668126 ATGAAACAAGGGACTGACTGTGG - Intergenic
1066083247 10:31952980-31953002 ATGAAATAAAGGAGTGAGGACGG + Intergenic
1066128242 10:32363369-32363391 AAGAAAAAATGGGCTGAGCACGG - Intronic
1066297442 10:34067247-34067269 ATGAGGAAGTGGGCTGAGTAGGG - Intergenic
1066406202 10:35121009-35121031 ATGGAAAAATGAACTTAGAAAGG - Intergenic
1066548423 10:36527262-36527284 ATTAAGAAATAGACTGAGCACGG - Intergenic
1067122784 10:43488965-43488987 ATGAAAAAATTAGCTGGGTATGG + Intergenic
1067413655 10:46086762-46086784 ATTAAAAAATGGACAGAGGCCGG - Intergenic
1067808240 10:49407934-49407956 ATGAAAAAATGGATGGATGAAGG + Intergenic
1068029823 10:51692629-51692651 ATGTAAAAATTAGCTGAGTATGG - Intronic
1068302827 10:55167267-55167289 ATATAAAAATGACCTGAGTATGG - Intronic
1068603271 10:58978134-58978156 ATGAAATAAAGGAGTGAGTCAGG + Intergenic
1068711805 10:60143009-60143031 ATGAAATAATGCACAAAGTAAGG + Intronic
1068865164 10:61887390-61887412 ATGAAAAAATTAACTGGGCAGGG - Intergenic
1071801624 10:89069666-89069688 ATGAAAAAATGGATTCAGAATGG - Intergenic
1071915663 10:90292642-90292664 CTGAAAAGGTGGACTGAGGAAGG + Intergenic
1071946808 10:90655150-90655172 TTGAATCAATGGACTAAGTAAGG - Intergenic
1072041114 10:91607922-91607944 ATAAAAACCTGGACTGAGGATGG - Intergenic
1073093745 10:100967712-100967734 AAGAGATGATGGACTGAGTAAGG - Intergenic
1073270784 10:102261910-102261932 AAGAAAATATGGGCTGAGCACGG - Intronic
1073806231 10:107101334-107101356 ATGAAAAAATAGACCGGGCACGG - Intronic
1073901515 10:108227638-108227660 ATGAAAAAATGACCTGACAAAGG - Intergenic
1074131429 10:110581372-110581394 ATACAAAAATTAACTGAGTATGG - Intronic
1074633152 10:115281839-115281861 ATGAAAATATGCACTGAGTTTGG - Intronic
1074744703 10:116520671-116520693 AGGAAAAAATGGACTGCAAAGGG - Intergenic
1075231798 10:120686369-120686391 ATGAGAAAATGGATGGAGTTGGG - Intergenic
1077337103 11:2010319-2010341 ATGAGCAAGTGGACTGACTAAGG + Intergenic
1077733881 11:4767374-4767396 ATGAAATAATGGACTTATTGGGG - Intronic
1077901067 11:6489177-6489199 AAGTACAGATGGACTGAGTACGG - Intronic
1078257065 11:9667404-9667426 ATACAAAAATGAACTGAGCATGG - Intronic
1078272936 11:9813481-9813503 ATGCAAAAATTAACTGGGTATGG - Intronic
1078992434 11:16663476-16663498 ATGCAAAAATTAGCTGAGTATGG - Intronic
1079071992 11:17355239-17355261 ATGAAAAAATTAGCTGAGCATGG + Intronic
1079604622 11:22349439-22349461 ATGAATAGATGGATTGAGGAGGG + Intronic
1079629779 11:22659863-22659885 AGGAAAAAATGGAGGGAGGAAGG + Intronic
1080105763 11:28510452-28510474 GTGAGAAAATGGAGTGAGTTTGG + Intergenic
1080393394 11:31868620-31868642 ATGAAAAAATGGGCTAGGTGTGG - Intronic
1080446479 11:32342643-32342665 AGGAAAAAGTGAACTGAGAAAGG - Intergenic
1080694109 11:34585942-34585964 AAGAAAGAATGGATTGATTAGGG - Intergenic
1080766615 11:35303127-35303149 ATGCTAAAATTTACTGAGTATGG - Intronic
1081827401 11:46070091-46070113 CTGAAACAAAGGACTGGGTAGGG - Intronic
1083013693 11:59428886-59428908 TTGAACCAGTGGACTGAGTAAGG + Intergenic
1083705688 11:64512736-64512758 ATTAAAAAATTGGCTGGGTATGG + Intergenic
1084102805 11:66960919-66960941 ATTAAAAAATGGGCTGGGCACGG + Intergenic
1084985219 11:72864268-72864290 ATAAAAATATGGACTGGGTGTGG + Intronic
1084987691 11:72891070-72891092 AAAAAAAAATGAGCTGAGTATGG - Intronic
1085487266 11:76875947-76875969 ATGAAAAAATTAACTGGGTGTGG - Intronic
1085819293 11:79774779-79774801 ATGAAAAAATTAACTAGGTATGG - Intergenic
1086205037 11:84248087-84248109 ATGAGAAAATAGACTGTGAAAGG + Intronic
1087292747 11:96338374-96338396 ATGAAGAAACTGGCTGAGTAAGG + Intronic
1087416112 11:97857900-97857922 ATGAGAAAATGGAATGTGTTTGG + Intergenic
1088353379 11:108914799-108914821 ATGGAAAAATGTTCTGAGCAGGG + Intronic
1088751492 11:112845815-112845837 TTGAATCAGTGGACTGAGTAAGG + Intergenic
1089438889 11:118497686-118497708 ATAAAAAAATGAGCTGGGTATGG - Intronic
1089575993 11:119444240-119444262 TTTAAAAAATGGACTGAAAACGG - Intergenic
1089649498 11:119903445-119903467 TTGAATCAGTGGACTGAGTAAGG - Intergenic
1089994039 11:122887798-122887820 TAGCAAAAATAGACTGAGTAGGG + Intronic
1091258170 11:134209898-134209920 ATGCAAAAATTGGCTGAGTGTGG + Intronic
1202820087 11_KI270721v1_random:65501-65523 ATGAGCAAGTGGACTGACTAAGG + Intergenic
1092571534 12:9729088-9729110 ATGAAAAATTGGACTATGTTTGG + Intronic
1092609390 12:10155314-10155336 ATGCAAAAATTTGCTGAGTATGG + Intergenic
1093429820 12:19071839-19071861 ATGAAAAAATTGACATAGTAAGG + Intergenic
1093678311 12:21970114-21970136 AGGTAAAAATTGACTGAGTTGGG + Intergenic
1094350669 12:29521335-29521357 TGGAAAGCATGGACTGAGTATGG - Intronic
1095192529 12:39273868-39273890 TTGAAAAAATGGAATGAATGAGG + Intergenic
1095525874 12:43124541-43124563 ATGAATAAAGGGATTGAGTGGGG + Intergenic
1096149906 12:49302634-49302656 ATTAAAAAATTAACTGGGTATGG - Intergenic
1096221543 12:49832079-49832101 ATGAAAAAATTAGCTGGGTATGG - Intergenic
1096382234 12:51168638-51168660 ATAAAAAAATTAGCTGAGTATGG - Intronic
1096894171 12:54803385-54803407 AAGTACAGATGGACTGAGTAAGG - Intergenic
1098595124 12:72264257-72264279 ATTAAAAAATAAACCGAGTAAGG + Intronic
1099451160 12:82808557-82808579 ATGAAGAAATGAAAGGAGTAAGG - Intronic
1099580224 12:84436571-84436593 TTGAAACAGTGGACTGAATAAGG - Intergenic
1099609628 12:84851268-84851290 AGGAGAAAATGTACTGAGTAAGG - Intergenic
1099614485 12:84917275-84917297 ATGAAAAAATTAACTGGGCATGG - Intergenic
1100034648 12:90235983-90236005 TTGAATAAATGGAATGAGTAAGG + Intergenic
1100546166 12:95604837-95604859 ATGAAAAAATTAACTGGGCATGG + Intergenic
1100694812 12:97081135-97081157 ATCAGGAAATGGACTGAGCATGG - Intergenic
1101179304 12:102194826-102194848 ATGAAAAAAAGAACTAAGTGAGG - Intronic
1101480979 12:105096884-105096906 AGGAAAACATGGGCTGAGTATGG - Intergenic
1101755611 12:107618613-107618635 ATGGAAAGATGGTCTGAGGATGG - Intronic
1101802243 12:108032659-108032681 ATGAAAAAATTAGCTGAGTATGG - Intergenic
1101915803 12:108894869-108894891 ATAAAAAAATTGGCTGAGCATGG - Intronic
1101918454 12:108913939-108913961 ATGAAGAAATGGGCTGGGCATGG - Intronic
1101986802 12:109453481-109453503 ATAAAGAAAAGGACTGAGCATGG - Intronic
1102411365 12:112722473-112722495 ATGAAGAAGTAGACTGAATATGG - Intronic
1102461369 12:113101803-113101825 ATGAATAAATGGACACAGCAAGG + Intronic
1102593486 12:113974853-113974875 ATGAAAAAATGGACTAGGCCAGG - Intergenic
1102835111 12:116049541-116049563 AGGAAAAAATAGACGAAGTATGG + Intronic
1103283277 12:119778540-119778562 AAGAAATAATCGACTGAGCAAGG + Intronic
1103612350 12:122131603-122131625 ATGAAGAAATGAACTGGGTGTGG - Intronic
1103682485 12:122705598-122705620 AAAAAAAAAAGCACTGAGTATGG - Intergenic
1103684215 12:122719023-122719045 AAAAAAAAAAGCACTGAGTATGG - Intergenic
1103996812 12:124835413-124835435 ATGAAAAAATTAGCTGAGTATGG - Intronic
1104359075 12:128115133-128115155 ATGAAGAAATGGGCTGGGTGTGG - Intergenic
1105476541 13:20732863-20732885 ATGGAAAACTGGAGTGAGTTGGG - Intronic
1106282086 13:28283587-28283609 ATGATAAAATATACTGTGTATGG - Intronic
1106520941 13:30497224-30497246 ATCCAAAAATGGAATGAGTGCGG - Intronic
1106643922 13:31613066-31613088 ATGAAACAAAAGGCTGAGTAAGG - Intergenic
1106666424 13:31856051-31856073 ATGAAAATAGGGGCTGGGTATGG + Intergenic
1106840252 13:33679093-33679115 ATGAAAAAAAGGCATGAGAAAGG + Intergenic
1107038590 13:35925628-35925650 ATCAAAAAATGCACTGAAAATGG - Intronic
1107308187 13:39045982-39046004 ATGAAAGAATGGACTGGGAGTGG - Intronic
1107336224 13:39358880-39358902 GTGAAAAAATAGACTGGGTGTGG + Intronic
1107408217 13:40135110-40135132 AAGAAAAAATTAGCTGAGTATGG + Intergenic
1108861735 13:54868897-54868919 ATGAGAAAATGGTCTGAGGCTGG - Intergenic
1108875117 13:55037827-55037849 ATGTAAATATGGAGTCAGTAAGG + Intergenic
1109063253 13:57648492-57648514 TTTTAAAAATGCACTGAGTATGG - Intronic
1109447772 13:62466709-62466731 ATGAAGAAATCGGCTGGGTAAGG + Intergenic
1109509138 13:63346380-63346402 AGGAAAAAAGGGGCTGGGTACGG + Intergenic
1109590380 13:64472618-64472640 ATAATAAAATGGACTGGGTGTGG - Intergenic
1109730344 13:66404925-66404947 ATAAAAAAATGGAAAGAGGATGG - Intronic
1110132899 13:72029117-72029139 AAGAAAAAATGCACTGAAGAGGG + Intergenic
1110139231 13:72106650-72106672 AGGAAATAATGGAATGGGTATGG + Intergenic
1111363765 13:87212755-87212777 ATAAAAAAATGGGCTGAGTGCGG + Intergenic
1112720246 13:102236163-102236185 ATGAAAGAATAGACAGAGCAGGG - Intronic
1113064940 13:106363363-106363385 ATGAAGAAATGTACAGGGTATGG + Intergenic
1113366980 13:109685338-109685360 TTGAGAAAATGAACTGGGTATGG + Intergenic
1113846928 13:113397454-113397476 ATAAAAAAATTAACTGAGTGTGG - Intergenic
1114986447 14:28235555-28235577 ATTAAAAAATCGACTGGGCATGG - Intergenic
1115233199 14:31183861-31183883 ATAAAAAAATTAACTGGGTATGG - Intronic
1115333732 14:32224670-32224692 ATGAAAAAATAGCTTGAGTAAGG - Intergenic
1115389504 14:32838736-32838758 ATGCAAAAAGAGACTGGGTAAGG - Intergenic
1115549134 14:34489322-34489344 TTGAAAAAAGGGACAGAGCATGG + Intergenic
1116288970 14:43007453-43007475 ATGAATAACTATACTGAGTATGG + Intergenic
1116416874 14:44688627-44688649 CTGAAAAAATGGAGGGAGTATGG + Intergenic
1116933825 14:50716922-50716944 ATAAAAAAATGTACTAAGTGTGG - Intergenic
1117178343 14:53168140-53168162 ATGAAGGAATGGAATAAGTACGG + Intergenic
1117477892 14:56116168-56116190 ATGAGCAAATGGGCTGAGTGAGG - Intergenic
1117789280 14:59322364-59322386 AAGAAAAAATTGACTGGGAATGG + Intronic
1118072411 14:62259930-62259952 ATGTACAAATGGAATGGGTAGGG + Intergenic
1118393645 14:65317358-65317380 ATGAAGAAATGGATAGAGAATGG + Intergenic
1118690084 14:68329824-68329846 ACGAAAAAATGGGCTGGGCATGG + Intronic
1118802576 14:69204413-69204435 ATCAAAAAATGTGCTGAGCATGG + Intronic
1119219804 14:72897257-72897279 ATTAAAAAATGAACTGAGTATGG - Intergenic
1119682217 14:76601271-76601293 ATGAAAAAATACAATGAATAGGG + Intergenic
1120817325 14:88875913-88875935 ATGAAAAAAATGAGTGAGGAAGG - Intronic
1121816451 14:96932639-96932661 ATGAAGACATGGTCTGAGGATGG + Intergenic
1121904542 14:97727656-97727678 ATGATGGAATGGGCTGAGTATGG + Intergenic
1122398248 14:101450584-101450606 AGGAACAAATGGCCTGAGAAGGG - Intergenic
1123915030 15:25015779-25015801 ATATAAAAATGAGCTGAGTATGG + Intergenic
1125049941 15:35284963-35284985 ATGAAAAAATTAGCTGAGCATGG - Intronic
1125901668 15:43353832-43353854 ATGAAGAAATGGATAGAGCAAGG - Exonic
1126612199 15:50540912-50540934 AAAAAAAAATAGACTGAGTGCGG - Intronic
1127001926 15:54518892-54518914 TTGTGAAAATGGACTGGGTAGGG - Intronic
1127052667 15:55101073-55101095 AGGTAAAAATGGAAGGAGTATGG - Intergenic
1127505624 15:59595363-59595385 ATAAAAAAATTAACTGGGTATGG + Intronic
1128221099 15:65969267-65969289 ATGAGAAAGTGGACTGAAAAAGG + Intronic
1128440303 15:67701133-67701155 ATGAAGAAATGGAGAGAGGAAGG + Intronic
1128775908 15:70320330-70320352 AAGAGAAAATTGACTGAATAGGG + Intergenic
1129558786 15:76542998-76543020 TTAAAAAAATGTACTGAGTTTGG - Intronic
1129922898 15:79335586-79335608 AGGAAAAACTCTACTGAGTAAGG + Intronic
1131741993 15:95402962-95402984 TTGAATCAATGGACTGAGTCAGG + Intergenic
1131902614 15:97104798-97104820 TTGAATCAGTGGACTGAGTAAGG + Intergenic
1132200226 15:99948010-99948032 AAGTAAAAATAAACTGAGTAAGG - Intergenic
1133187173 16:4108339-4108361 ATGAAGAAACGGTCTGATTAAGG - Intronic
1133231386 16:4368590-4368612 ATGCAAAAATGAGCTGAGCATGG + Intronic
1134588417 16:15432626-15432648 ATGAAAAAATAGACCAATTATGG + Intronic
1134591578 16:15458559-15458581 ATGAAAAAATTAGCTGAGTATGG + Intronic
1134632237 16:15765161-15765183 ATGAATAAATGGATAGAGGATGG + Intronic
1134901021 16:17938050-17938072 AAGAACAAATAGGCTGAGTAGGG - Intergenic
1135540790 16:23328949-23328971 CTTAAAAAATGAACTGGGTATGG - Intronic
1137797229 16:51232234-51232256 ATGAAAAAATCAGCTGAGCATGG - Intergenic
1137952989 16:52801222-52801244 ATGGAAAAAGGTACTGAGTCTGG - Intergenic
1137956642 16:52838030-52838052 ATAAAAAGATGGACTGGGCATGG - Intergenic
1138385629 16:56634009-56634031 TGGAAAAAATGGACTGGGTGGGG + Intergenic
1138503918 16:57466846-57466868 ATTAGAAAATGGACTGATTCTGG - Intronic
1138589032 16:57989632-57989654 ATGATGAAATGGACTCAGGAAGG + Intergenic
1138734496 16:59234861-59234883 ATGTAAAAATGGACTGTTTGCGG + Intergenic
1139732569 16:68959296-68959318 AGGAAAAAATGGGCCGAGTGCGG + Intronic
1141495638 16:84407624-84407646 ATGAAAAAATGAGCTGGGCATGG - Intronic
1141710525 16:85696338-85696360 ATCAAAAAATTGGCTGGGTATGG - Intronic
1142389639 16:89790571-89790593 ATACAAAAATGAACTGGGTATGG + Intronic
1143604356 17:7973226-7973248 ATGCAAAAATTAGCTGAGTATGG + Intergenic
1144129538 17:12232787-12232809 ATGAAAAAAGAGACTGGGTGCGG + Intergenic
1145775108 17:27522256-27522278 AGGAAAAACAGGACTGAGAAGGG + Intronic
1146394336 17:32450964-32450986 ATAAAAAAATTGACTGGGTGTGG + Intronic
1146430238 17:32786471-32786493 AAGATAAAATGCACTGAGTTTGG - Intronic
1146616711 17:34362484-34362506 ATGCACAAATGGACAGAGTGGGG - Intronic
1146772752 17:35583909-35583931 TTGAAAAAATTGGCTGAGTTTGG + Intronic
1146821294 17:35985207-35985229 CAGAAAAAATGGGTTGAGTAGGG - Intronic
1146981459 17:37165829-37165851 ATGCAAAAATTGGCCGAGTATGG - Intronic
1147223594 17:38956295-38956317 ATGAAAAAATTGGCTGGGCAAGG + Intronic
1147545976 17:41402157-41402179 AGGAAGAAATGGAGTGGGTAGGG - Intergenic
1148429356 17:47629434-47629456 TTGAAAAAATTAACTGAGTGTGG + Intergenic
1148657296 17:49296573-49296595 ATTAAAAAATGGACTGGGCATGG + Exonic
1149747383 17:59112258-59112280 ATGAAGAAATGGACTTGGAAAGG - Exonic
1149769436 17:59308744-59308766 CTAAAAAAATGGGCTGAGTGGGG + Intergenic
1150435509 17:65151187-65151209 ATACAAAAATTGACTGAGCATGG + Intronic
1152050452 17:77970851-77970873 ATGAAAAAATTAGCTGAGCATGG + Intergenic
1152171962 17:78757101-78757123 ATGAAAAAATTAGCTGGGTATGG - Intronic
1153925279 18:9830301-9830323 ATGAAAAAAAGAACTGGGTGCGG - Intronic
1154956726 18:21265448-21265470 ATGAAAAAATGGACGGTGATGGG + Intronic
1156375442 18:36511306-36511328 ATGAAAAAAATGACTGGGTTTGG + Intronic
1156909253 18:42391378-42391400 ATGAAAACATGGACTACGGAGGG + Intergenic
1158051930 18:53232754-53232776 ATTAAAATATGGCCTGGGTATGG - Intronic
1158257750 18:55572407-55572429 CTGAGAAAATGGAGTGAGGAGGG + Intronic
1158318257 18:56235857-56235879 ATGAAAAAAGGGTCTCAGGAAGG - Intergenic
1159201878 18:65197061-65197083 ATGAAAAAATGGGCTGAGCGTGG - Intergenic
1159597959 18:70401533-70401555 TTGAATCAAAGGACTGAGTAAGG + Intergenic
1159744688 18:72217670-72217692 TTTTAAAAATGGACTGAATAAGG - Intergenic
1161432469 19:4241065-4241087 AATAAAAAATGGACTGAGCATGG - Intergenic
1162653659 19:12111768-12111790 ATGAAAGAATGCACAGAGGAGGG + Intronic
1163112207 19:15168369-15168391 ATTAAAATATGGACAGAGGAAGG + Intronic
1164521375 19:28982655-28982677 AAGGAAAAATGGACAGAGAAGGG + Intergenic
1164798043 19:31052032-31052054 TTGAATCAGTGGACTGAGTAAGG - Intergenic
1164932229 19:32184707-32184729 ATAAAAAAATGAGCTGAGTGTGG - Intergenic
1165168985 19:33877702-33877724 ATGAAGAAATGTAGTGGGTAGGG + Intergenic
1165718016 19:38059154-38059176 AAAAAAAAATGAGCTGAGTATGG - Intronic
1165920563 19:39295232-39295254 TTGAATCAATGGACTGAGTAAGG - Intergenic
1166793333 19:45410977-45410999 ATGAAAAAATGAGCTGGGTGTGG - Intronic
1167631287 19:50627763-50627785 ATGAATCAATGGAATGAGTGAGG + Intronic
1167941857 19:52953882-52953904 ATAAAAAAATTGGCTGAGCATGG + Intronic
1168029492 19:53668443-53668465 ATGCAAAAATTAACTGGGTATGG - Intergenic
1168220408 19:54956397-54956419 AGGAAAAACAGGACTGGGTATGG + Intronic
1168492669 19:56823592-56823614 CTGAAAGAATGGACTGAGTGAGG + Exonic
925178996 2:1804486-1804508 ATAAAAAACTGGCCTGAGCAGGG + Intronic
925628978 2:5869380-5869402 AAGGAAATATGGACAGAGTAAGG - Intergenic
925663410 2:6226280-6226302 ATAGAAATATGAACTGAGTAGGG - Intergenic
925702234 2:6650402-6650424 ATGAAAAAAGAGGCTGAGAAGGG + Intergenic
926606320 2:14902285-14902307 ATGCAAAAATTAGCTGAGTATGG - Intergenic
927136846 2:20103453-20103475 ATGAATAAATGAAATGATTATGG + Intergenic
927286205 2:21359706-21359728 AAGGAAATATGGAATGAGTAGGG - Intergenic
927344746 2:22024894-22024916 ATGAGAGAATAAACTGAGTAGGG - Intergenic
927390497 2:22589338-22589360 ATTAAAAAATGGGCTGAGCACGG - Intergenic
927622107 2:24672227-24672249 CTGAAAAAAGGGACAGAGGAGGG + Intronic
927946170 2:27136614-27136636 ATAAAAAAATTAGCTGAGTATGG - Intergenic
928010580 2:27603886-27603908 ATTAAATAATGGGCTGAGCAGGG - Intronic
928497270 2:31846385-31846407 ATGAAAAACTGGGCTGGGCACGG - Intergenic
928890450 2:36197715-36197737 ATGGCAAAATGGACTTTGTATGG + Intergenic
929410148 2:41689888-41689910 ATAGAAAAATGGACTGAGGTTGG - Intergenic
931100717 2:58997841-58997863 ATGAAAAAATGAGCTGGGTGGGG + Intergenic
931748158 2:65308579-65308601 AATAAAAAAGGGACTGAGAAAGG + Intergenic
931789722 2:65654125-65654147 TTTAAAAAATTGACTCAGTATGG - Intergenic
931841013 2:66148274-66148296 ATGAAATAATCGACACAGTATGG + Intergenic
932176466 2:69607338-69607360 ATCAGAAAATGGGCTCAGTAAGG + Intronic
932207901 2:69899971-69899993 AAAAAAAAATGGACTGAGGCAGG - Intronic
932835481 2:75031926-75031948 ATGAAAACCTGGACTGGGCACGG + Intergenic
933296706 2:80499100-80499122 ATCAATAAAGGGACAGAGTAGGG - Intronic
933453787 2:82495419-82495441 ATGAAAATATGAACTGAATTTGG + Intergenic
933910860 2:86940452-86940474 ATGCAAAAATTAACTGGGTATGG - Intronic
934021868 2:87962958-87962980 ATGCAAAAATTAACTGGGTATGG + Intergenic
934639287 2:96017655-96017677 ATGCAATAATGGATTCAGTAAGG - Intergenic
935030810 2:99320161-99320183 ATGTAAAAATTAACTGAGCATGG - Intronic
935054874 2:99556764-99556786 ATGAAAAAATGAGCTGGGTGTGG + Intronic
935637734 2:105262557-105262579 ATGCAAAAATGGACTGACGCAGG + Intergenic
935693242 2:105748555-105748577 ATAAAAAAATTCACTGAGCATGG - Intronic
935990746 2:108717064-108717086 ATGCAAAAATTAACTGGGTATGG - Intergenic
936661203 2:114546107-114546129 ATGAAAAAATGGACTGATACAGG - Intronic
937077391 2:119117166-119117188 AGGAAGAAATTGACTAAGTAAGG + Intergenic
938662459 2:133501819-133501841 ATGAAAAATTGAATAGAGTAAGG - Intronic
939188272 2:138885618-138885640 ATTAAAAAATTAACTGAGCATGG - Intergenic
939284280 2:140109116-140109138 ATGAAAATATGGTCTCAGAAAGG - Intergenic
939454950 2:142421960-142421982 ATGAATACATAGAATGAGTATGG - Intergenic
939571516 2:143845884-143845906 ATGACTCAAAGGACTGAGTAGGG + Intergenic
939585478 2:143999155-143999177 TTGAAAACATGAAATGAGTAGGG + Intronic
939647103 2:144713876-144713898 ATGAAAACATTTACTGAGGAAGG - Intergenic
939998177 2:148939746-148939768 AAGAAAAAGAGGACTGACTAAGG + Intronic
940448507 2:153808378-153808400 AAGAAAAAATGGGCTGAAAATGG - Intergenic
940676804 2:156733448-156733470 TTGAATCAGTGGACTGAGTAAGG + Intergenic
942741732 2:179188480-179188502 ATACAAAAATTGGCTGAGTATGG + Intronic
942831449 2:180241080-180241102 ATGAAAAGCTGGGCAGAGTAAGG - Intergenic
942932260 2:181508984-181509006 ATGAAAAAATGGGCTGGGCATGG + Intronic
943338502 2:186647641-186647663 ATGTAAAAAGAGACTGAGAAAGG + Intronic
943831905 2:192473697-192473719 ATGAACAAATGAACTAAATAAGG + Intergenic
944079299 2:195769125-195769147 ATGAAAGAATGGCATGAGAAAGG + Intronic
944153355 2:196585704-196585726 AGGAAAAAATGGAGGGAGGAAGG + Intronic
944248304 2:197555800-197555822 TTTAAAAAATTAACTGAGTATGG + Intergenic
944333422 2:198500031-198500053 ATGAAACAATGGGATAAGTATGG + Intronic
945415095 2:209560914-209560936 ATGATAAATTGGACAGAGGACGG + Intronic
945554239 2:211259493-211259515 AGGAAAAAATGGAGGGGGTAAGG + Intergenic
945801296 2:214434601-214434623 ATGAGGAAATGGGCTGAGAAAGG - Intronic
946540220 2:220676106-220676128 CTCAGAAAATGGGCTGAGTAAGG + Intergenic
946826187 2:223680618-223680640 AAGAGAAAATAGACTGAGCATGG + Intergenic
946970036 2:225081385-225081407 ATAAAAAAATGGAATGAGAATGG + Intergenic
947166473 2:227267454-227267476 ATGAAAAAATGGACTGAGTAGGG - Intronic
947391070 2:229639996-229640018 AAGAAAAACTGTACTGAGAAAGG + Intronic
948029075 2:234801522-234801544 ATGAAAAAATTGCTTGTGTAGGG + Intergenic
948070007 2:235113583-235113605 ATTAAAGAAAGGACAGAGTAAGG - Intergenic
948248941 2:236509508-236509530 ATAAAACAATGGAATGAGAAAGG + Intergenic
948492968 2:238325519-238325541 ATGAGAAAATGAAATGAGAAAGG - Intronic
1168946181 20:1760145-1760167 CTGAATCAGTGGACTGAGTAAGG - Intergenic
1169151184 20:3290942-3290964 ATGAAAAAATTAGCTGGGTATGG - Intronic
1169826204 20:9771561-9771583 ATTAAAAAATTGACTGAATGTGG - Intronic
1170061843 20:12267030-12267052 ATCTAAAAATGGACTTAGAAAGG - Intergenic
1170621382 20:17999248-17999270 TTGAATCAGTGGACTGAGTAAGG - Intronic
1170965256 20:21062923-21062945 ATAAATAAATGGACTTAGCAAGG - Intergenic
1171045412 20:21805788-21805810 ATGAAAAAATGAAGTGTGGATGG - Intergenic
1172558538 20:35865343-35865365 ATGAAAAAATTGGCTGAGAGTGG + Intronic
1175244782 20:57575363-57575385 ATGAAAGGATGGATTGAGGATGG - Intergenic
1178385925 21:32150455-32150477 AAGAAAATATGGACTGGGTGGGG + Intergenic
1178459238 21:32787001-32787023 ATGTAAAAATGGGCTGGGCATGG + Intergenic
1180850406 22:19016471-19016493 ATGGAAAAATGGCCTGTGGATGG - Intergenic
1181300562 22:21877825-21877847 ATTAAAAAATTAACTGAGTGTGG + Intergenic
1181463352 22:23097992-23098014 ATGAAAAACTGGACTGACTCAGG - Intronic
1181715502 22:24724415-24724437 ATGAAAAAATTAGCTGAGCATGG - Intronic
1182742197 22:32576096-32576118 ATGAAGCAATGGCCTGAGTATGG + Intronic
1183146167 22:35994559-35994581 ATTAAAAAATTAACTGGGTATGG - Intronic
1183244869 22:36685796-36685818 ATGGAAAGATGGACGGAGGAAGG - Intronic
1184791844 22:46704869-46704891 ATGAGAACATGGACTAAGCAAGG + Intronic
949101330 3:149377-149399 AGGAAAAAAAGGAGTGAGAATGG - Intergenic
949916143 3:8966112-8966134 GTGATAAAATGGACAGAGGAGGG + Intergenic
950840837 3:15966843-15966865 ATTATAAAATGGATTGTGTATGG + Intergenic
951574781 3:24102488-24102510 ATGAAAAAAGGCACTGTGTTAGG - Intergenic
952248324 3:31622688-31622710 TTGAAAGTATGCACTGAGTATGG - Intronic
952442502 3:33346326-33346348 ATGAAATAATGGGCTGAGGCAGG + Intronic
952772398 3:37014158-37014180 TTGAAAACACTGACTGAGTAGGG + Intronic
952867914 3:37868562-37868584 ATTAAAAAATGGACTCAGAATGG - Intronic
953080490 3:39612150-39612172 ATTAAAAAAAGGGCTGAGTTTGG + Intergenic
953324489 3:42001428-42001450 ATTGAAAAATGGACTGAGGTAGG + Intergenic
953575644 3:44111157-44111179 ATGAAGAAATGCACTTAATATGG + Intergenic
954025241 3:47777822-47777844 ATTAAAAATTGGACTGAGACTGG - Intronic
954168930 3:48784135-48784157 ATGAAACAATGGTCTCAGTCTGG + Intronic
954203631 3:49041259-49041281 ATGAAAAGATGGGCTGGGTGCGG - Intronic
954269065 3:49493197-49493219 ATGAAAAAATTGGCTGAGTGTGG - Intronic
954562274 3:51567495-51567517 CTGCAAAAATGGAATCAGTAGGG + Intronic
955331396 3:58050396-58050418 ATGAAATCAAGGACTGAGTATGG + Intronic
956246864 3:67193068-67193090 ACGAAAAAAATGACTGAGTCAGG + Intergenic
956320505 3:67991441-67991463 ATGAATCAGTGGACTGAGTGGGG + Intergenic
956433712 3:69212415-69212437 AACAAAAGATGGACTGTGTAGGG + Intronic
957167501 3:76693889-76693911 TTGAATCAATGAACTGAGTAAGG - Intronic
957698312 3:83673815-83673837 TTGAAAAAATATACTGAGTTTGG + Intergenic
958036012 3:88171340-88171362 TTGAATCAGTGGACTGAGTATGG + Intergenic
958059226 3:88457403-88457425 TTTAAAAAATCGACTGGGTATGG + Intergenic
958830267 3:99079064-99079086 ATGAGTAAATGGTCTGAGTGGGG + Intergenic
959035380 3:101357154-101357176 ATGCAAAAATTGACTGGGCATGG - Intronic
959235763 3:103719502-103719524 CTGAAAAAGTGGACTGACTTTGG - Intergenic
959353045 3:105292295-105292317 ATGCAATAATAGACTGATTAGGG - Intergenic
959711076 3:109386421-109386443 ATGAAAAAATTAACCGAGTGTGG - Intergenic
959999452 3:112715384-112715406 TTGAATAAACAGACTGAGTAAGG + Intergenic
960079879 3:113530094-113530116 ACCAAAAAATGGAATGAATAAGG + Intergenic
960203986 3:114872643-114872665 AAAAAAAAAAGGACTGACTATGG + Intronic
960222101 3:115125185-115125207 ATTAAAAAATTAACTGAGCATGG + Intronic
960329551 3:116341822-116341844 TTGAGAAATTGGACTCAGTACGG + Intronic
960511516 3:118554808-118554830 ATTAAAAAAAAGACTTAGTAGGG - Intergenic
960781016 3:121316830-121316852 GTGAAAAAATGGGCAGAGAAAGG - Intronic
961189156 3:124942963-124942985 AGGAATAACTGGACTGGGTAAGG - Intronic
961767650 3:129224289-129224311 ATGCAAAAATTGGCTGAGCATGG + Intergenic
962363781 3:134763549-134763571 ATGAAAACATGTACTGGGCAGGG - Intronic
962403159 3:135078596-135078618 ATGGACAAATGGACAGAGAAAGG + Intronic
962534538 3:136316061-136316083 ATTAAAAAATTAACTGAGCATGG + Intronic
962673324 3:137731746-137731768 ATGAAAACATGGACACAGGAAGG - Intergenic
962956608 3:140272594-140272616 ATGCAAAAATTAACTGGGTATGG + Intronic
963241075 3:143002900-143002922 ACGAGAAAATGTACTGAGGAGGG - Intronic
963430542 3:145196824-145196846 AAGAAAAGATGCACTGAGGAGGG + Intergenic
963487139 3:145949064-145949086 ATAAAAAAATGAACTCAGGATGG + Intergenic
964103946 3:153019654-153019676 AAGAAAAAAAGCACTGAATAGGG + Intergenic
964186815 3:153955440-153955462 ACGAAAAAGTGGCATGAGTAGGG - Intergenic
964799807 3:160543621-160543643 TTGAAAAAATTGGCTGGGTATGG - Intronic
964950135 3:162280867-162280889 ATGCAAAAATGGACTCAAGATGG - Intergenic
964966940 3:162506094-162506116 ATGGAAAAATGGGCTGGGCATGG + Intergenic
966554844 3:181247099-181247121 ATTAAAAAATGGACAGAATATGG - Intergenic
966859839 3:184224558-184224580 GTGAGTAAGTGGACTGAGTAGGG - Intronic
967388876 3:188936171-188936193 ATGCAAAAATTAGCTGAGTACGG - Intergenic
969227700 4:5809848-5809870 ATGGAAAAATGGAGTCAGTTAGG - Intronic
969434976 4:7183854-7183876 ATGGAAATATGTGCTGAGTATGG - Intergenic
970457004 4:16234435-16234457 ATGGAAAACTGGGCTGAGGACGG + Intergenic
971133815 4:23843607-23843629 ATGAACAAATGGAGTGAAAAAGG + Intronic
971173524 4:24258839-24258861 ATGAATAAATGGTCTGAGAGTGG - Intergenic
971697093 4:29919807-29919829 ATGAAATCATGGCCTGAATAAGG - Intergenic
972064012 4:34916424-34916446 ATGAAAAAATTACCTGAGTGTGG + Intergenic
972599184 4:40556732-40556754 ATAAAAAAATTCACCGAGTATGG + Intronic
972764941 4:42143884-42143906 AAGAAATCATGGACTGAGAATGG + Exonic
973170189 4:47132610-47132632 ATGAAAAAAAGGACCAAGTGTGG + Intronic
974373705 4:61049351-61049373 ATGAAAAAATGGGATGAGACAGG + Intergenic
974784720 4:66603917-66603939 AGGAAAAAATTGACTGAGATTGG + Intergenic
975339532 4:73223940-73223962 ATGAAAAAATGCACTGAAAAAGG + Intronic
975357054 4:73419431-73419453 ATAGAAAAATGGAGAGAGTAAGG - Intronic
975927082 4:79470030-79470052 TTGAAACACTGGACTAAGTATGG + Intergenic
976723123 4:88189356-88189378 ATTAAAAAATGAGCTGAGCATGG + Intronic
976794003 4:88912204-88912226 TTGAATCAATGGGCTGAGTAAGG + Intronic
977402744 4:96554635-96554657 CTCAGACAATGGACTGAGTAAGG - Intergenic
977984450 4:103365562-103365584 ATGGAATAATGGAGTGATTAAGG - Intergenic
978489347 4:109295135-109295157 ATGAAAAAATAGAATTATTAAGG + Intronic
978838972 4:113186918-113186940 GGTAAAAAATGAACTGAGTATGG - Intronic
979122094 4:116916328-116916350 ATGAAAAAAAGGACAGAAAAGGG + Intergenic
979255686 4:118605399-118605421 ATTAGAAAATGGACTGGGTGCGG - Intergenic
979387521 4:120086886-120086908 ATTAAAAAAATGACTGAGAAAGG - Intergenic
979436425 4:120698123-120698145 ATGAAAAAATGCAGTTAGTTGGG + Intronic
979868216 4:125782483-125782505 ATCAAAAATAGGACTGAGTGTGG + Intergenic
979870200 4:125809764-125809786 ATGCAAAAATTAGCTGAGTATGG + Intergenic
980122344 4:128741050-128741072 AGGAAAAAATTAACTGAGTGTGG + Intergenic
980503995 4:133691146-133691168 ATAAAAAAATTGACTCAGAATGG - Intergenic
980747729 4:137041626-137041648 AAGAAAAAATGGGCTGGCTAAGG + Intergenic
981036706 4:140176955-140176977 ATGAAAGAAATGACTGAGTTAGG - Intergenic
981137144 4:141223435-141223457 ATGAAAAAATGGAACTAATAAGG - Intronic
981967272 4:150619809-150619831 ATGAAAGAATGATCAGAGTAGGG - Intronic
982207576 4:153008359-153008381 ATAAAAAAATTAACTGAGTGTGG + Intergenic
982322091 4:154087786-154087808 ATGACAAAATGGAGTTATTATGG - Intergenic
983240989 4:165232576-165232598 TTAAAAAAATTGACTGAGCATGG + Intronic
983589271 4:169389764-169389786 ATGAAGAAATGGGCTGGGCATGG - Intergenic
984467051 4:180113042-180113064 ATGAAACAATGGATTAGGTATGG + Intergenic
984543735 4:181073921-181073943 ATGAAAACATGCACTGAATTGGG - Intergenic
984621995 4:181964135-181964157 AAAAAAAAATAGACTGATTAGGG + Intergenic
984718986 4:182952794-182952816 ACAAAAAAATTAACTGAGTATGG + Intergenic
1202765796 4_GL000008v2_random:147754-147776 AAGAAAAAATGGGGTGGGTAGGG - Intergenic
985787257 5:1903578-1903600 TTGAATCAGTGGACTGAGTAAGG - Intergenic
986761023 5:10879750-10879772 ATGGATAAATGGAAGGAGTAGGG - Intergenic
987017814 5:13837992-13838014 TTAAAAAAATGGACTGGGCATGG - Intronic
987170056 5:15245784-15245806 ATAACAAAATGGACTCAGTTTGG + Intergenic
987374685 5:17222746-17222768 GTTCAAAAATGTACTGAGTATGG - Intronic
987834917 5:23147512-23147534 ATATAAAAATGAACTGAGTGTGG + Intergenic
988201244 5:28072137-28072159 TTGAATCAATGGACTGAATAAGG + Intergenic
988645445 5:33090344-33090366 ATGAAAAAATGGGCAAAGTCAGG - Intergenic
988682093 5:33493455-33493477 TTGAAAAAATGGACGTATTATGG + Intergenic
988786531 5:34570436-34570458 ATCAAAACATGAACTGAGGATGG - Intergenic
990240361 5:53810835-53810857 TTGAATGAGTGGACTGAGTAAGG - Intergenic
990627439 5:57630471-57630493 AAGAAAAAATGGAAAGTGTAGGG + Intergenic
993185476 5:84613204-84613226 AAGAAAAAATGGGCTGGCTATGG + Intergenic
993740869 5:91537722-91537744 ATGACAAAAAGCACTGAGTATGG - Intergenic
995550683 5:113278107-113278129 ATGACAACATGGTCTGAGAAAGG + Intronic
995559067 5:113361675-113361697 TTGAATCACTGGACTGAGTAAGG + Intronic
996181518 5:120425936-120425958 ATGAAATAATGAAGTGAGAAGGG - Intergenic
996247761 5:121285673-121285695 ATGTAAAAATCGAGTGAATAGGG - Intergenic
997204440 5:132036039-132036061 ATAAAATAATGGATTCAGTAAGG + Intergenic
997451984 5:133991069-133991091 AAGTACAGATGGACTGAGTACGG - Exonic
998807299 5:145931185-145931207 ATACAAAAATTAACTGAGTATGG - Intergenic
1000762291 5:165241425-165241447 AAGAAAATATGAAATGAGTAGGG - Intergenic
1002214726 5:177622277-177622299 ATAAAAAAATTAGCTGAGTATGG + Intergenic
1002613110 5:180434271-180434293 ATAAAAAAATTGACTGTGCACGG - Intergenic
1003068277 6:2921321-2921343 AGGGAAAAATGGACTATGTATGG + Intergenic
1003233705 6:4277333-4277355 TTGAATCAGTGGACTGAGTAAGG + Intergenic
1003607768 6:7580219-7580241 ATATGAAAATGAACTGAGTAAGG + Exonic
1003829583 6:9993322-9993344 ATGAATGAGTGGACTCAGTAAGG + Intronic
1004555126 6:16689466-16689488 AAGAAAAAATTGACTGGGTGTGG - Intronic
1004667274 6:17760085-17760107 ATGAAACAAAGGACAGAGAATGG + Intronic
1004751301 6:18565463-18565485 ATGAAAAAAGGGAGGGAGGATGG - Intergenic
1004896378 6:20152028-20152050 AAGAAAAAATGGGCTGGGGATGG + Intronic
1004915329 6:20326931-20326953 ATAAAAAAATTAACTGAGCATGG + Intergenic
1005334618 6:24781923-24781945 ATGAAAAAATTAGCTGAGCATGG + Intronic
1005386752 6:25292876-25292898 ATCAAAATATGGAATGAATAGGG + Intronic
1005592843 6:27347310-27347332 ATAAAAAAATTAACTGAGCATGG + Intergenic
1006181963 6:32159142-32159164 ATTAAAAAATAGACTGGGTGTGG + Intronic
1006875824 6:37295258-37295280 ATAAAAAAATTGGCTGGGTATGG - Intronic
1007224522 6:40303394-40303416 ATGTCAAAAGGCACTGAGTAAGG + Intergenic
1007367941 6:41407670-41407692 ATGAAAAGACAGACTCAGTAGGG - Intergenic
1007428346 6:41761453-41761475 GGGAAGAAATGGAGTGAGTAGGG - Intergenic
1007489201 6:42205065-42205087 ATAAAAAAATGAGCTGAGTGTGG + Intergenic
1007804707 6:44432909-44432931 ATGTAAAAATGGACACAGCATGG - Intronic
1008753607 6:54766911-54766933 ATGAAAAAATTAACTGGGCATGG - Intergenic
1009055846 6:58334176-58334198 AAGCAAAAATGTACTGGGTAGGG - Intergenic
1009482882 6:64182482-64182504 ATGAAAAAATGAAAAGAGAATGG - Intronic
1009899319 6:69792527-69792549 AGGAAAGAATTGACTGAGAAGGG + Intronic
1010729586 6:79375820-79375842 ATGAAAATATGGAATGAAGAAGG - Intergenic
1010730277 6:79383342-79383364 ATGAAAAAATGGAAAGAGCCTGG - Intergenic
1010804426 6:80218187-80218209 ATGAGGGAATGGACTGAGCAAGG - Intronic
1010907845 6:81514882-81514904 ACAAAAAAATAAACTGAGTATGG + Intronic
1011160586 6:84385529-84385551 ATACAAAAATCAACTGAGTATGG + Intergenic
1011978420 6:93337929-93337951 AGGAAGAAATGGAGTGAGGATGG + Intronic
1012053057 6:94368202-94368224 AGGAAGAAATGGCCTGAGGATGG - Intergenic
1013533231 6:111039588-111039610 ATGCAAAAATTAACTGGGTATGG + Intergenic
1014015201 6:116521627-116521649 TTGAATCAGTGGACTGAGTAAGG - Exonic
1014137196 6:117904098-117904120 ATGAAAATATGCACAGAGCAGGG - Intergenic
1014196679 6:118568081-118568103 ATGATAAAATGGACTCGGTGTGG + Intronic
1014239139 6:118995259-118995281 ATGCAAAAATTAACTGAGTGTGG + Intronic
1014524581 6:122487258-122487280 ATGAAAGAAAAGACTGAATATGG - Intronic
1014972332 6:127832937-127832959 ATACAAAAATTAACTGAGTATGG - Intronic
1015079724 6:129209118-129209140 AGGAAAAAAAAGAGTGAGTAGGG + Intronic
1016804498 6:148199224-148199246 ATACAAAAATTAACTGAGTATGG + Intergenic
1017539648 6:155387392-155387414 ATGAAAAAATAGTCTTAGCAAGG - Intergenic
1018304564 6:162441666-162441688 ATGAAAACAGGGGCTGAGTTAGG + Intronic
1018575545 6:165256410-165256432 ATGAAAAGATTGACTAAGGAAGG - Intergenic
1018654002 6:166015140-166015162 TTGAATAAGTGGACTGAGAAAGG + Intergenic
1020397858 7:7737287-7737309 ATGATGACATGGACTCAGTAGGG + Intronic
1021171837 7:17406678-17406700 TTGAATCAGTGGACTGAGTAAGG + Intergenic
1021284283 7:18760208-18760230 ATCTAAAATTGGACTGAGCAGGG - Intronic
1022166128 7:27764457-27764479 CTGATAAAATGTACTGAGAAAGG - Intronic
1022190989 7:28016663-28016685 ATGACATAATGGCATGAGTAAGG - Intronic
1022770197 7:33462861-33462883 TTTAAAAAGTGGACAGAGTATGG - Intronic
1022869972 7:34466895-34466917 ATAAAAAAATCAACTAAGTACGG - Intergenic
1024037430 7:45520310-45520332 ATAAAAAAATTAACTGTGTATGG + Intergenic
1024108621 7:46120688-46120710 ATAAAAAAATTTACTGAGCATGG + Intergenic
1024749186 7:52445114-52445136 ATGATAAAATGGACTTAGTTAGG + Intergenic
1026211846 7:68312846-68312868 ATGAAAAAATTAGCTGAGTATGG - Intergenic
1026805467 7:73426950-73426972 AGGAAAAAATTAACCGAGTATGG - Intergenic
1027159040 7:75789075-75789097 ATCAAAAAATGAACTGGGCACGG - Intronic
1027299620 7:76817456-76817478 ATGAAAATACAGAATGAGTAAGG + Intergenic
1027644841 7:80785020-80785042 AGGAAAAAATGGAGGGAGGAAGG - Intronic
1028015519 7:85706320-85706342 ATCAAAAAATGTAATGAGCAAGG - Intergenic
1028890489 7:95982796-95982818 AAAACAAAATGGACTTAGTAGGG + Intronic
1029247579 7:99213764-99213786 ATGAAAACATTAGCTGAGTATGG - Intergenic
1029489882 7:100865251-100865273 ATGAAAAAATGGACCAGGCAGGG - Intronic
1029648248 7:101871860-101871882 ATTAAAAAATTGACTGGGCATGG + Intronic
1030078185 7:105754748-105754770 ATGAACCAATAGACTGAGTATGG - Intronic
1030133627 7:106224543-106224565 AAAAAAAAATAGACTTAGTAGGG + Intergenic
1030874175 7:114792820-114792842 ATAAAAAAATTGGCTGAGCATGG + Intergenic
1030940836 7:115647695-115647717 ATGAAAGAATGCACACAGTATGG + Intergenic
1031365836 7:120900118-120900140 AGGAAAGAATGGAGTGAGTGAGG - Intergenic
1032879956 7:136078180-136078202 ATGCAAAAATTGGCTGAGCATGG + Intergenic
1033163481 7:139017859-139017881 ATAAAAAAATTAACTGAGTGTGG + Intergenic
1033969051 7:147015269-147015291 TTGGTAAAATGGACAGAGTAGGG + Intronic
1034013312 7:147554441-147554463 AAGAAAAAATGGGCTGGGTATGG + Intronic
1034187529 7:149190452-149190474 ACAAAAAAATTGGCTGAGTATGG + Intergenic
1035116528 7:156529228-156529250 ATGTGAATATAGACTGAGTATGG + Intergenic
1035554643 8:557375-557397 TTGAATCAGTGGACTGAGTAAGG + Intergenic
1035897767 8:3423316-3423338 GAGAAAAAATGGACTGAAAATGG - Intronic
1035920635 8:3672189-3672211 TTGATGAAATTGACTGAGTATGG + Intronic
1037094138 8:14963251-14963273 ATGAAAAAATGGAATTAGATTGG + Intronic
1038069007 8:23992778-23992800 TTGAACCAGTGGACTGAGTAAGG - Intergenic
1038293888 8:26273509-26273531 ATGAGAAAATTAACTGAGTCTGG + Intergenic
1038723243 8:30056981-30057003 CTGAACAAATGGACAAAGTAAGG + Intergenic
1040598640 8:48863560-48863582 AAGAACAAATGGTCTGTGTAGGG + Intergenic
1041267848 8:56082511-56082533 ATGCAAAAATTAGCTGAGTATGG - Intergenic
1041469236 8:58190582-58190604 TTGAATCAGTGGACTGAGTAAGG + Intronic
1042719851 8:71815665-71815687 AGGAAAAGATGGACTGTGGAAGG - Intergenic
1043049350 8:75365267-75365289 GTAAAAAAATGGGCTGAGCACGG + Intergenic
1043869192 8:85412234-85412256 ACCAAAGAATGGAATGAGTAAGG + Intronic
1045498018 8:102724749-102724771 ATGAAAAAATTAACTGGGTATGG - Intergenic
1045921489 8:107535285-107535307 ATGAATAAATGAACTCATTAAGG + Intergenic
1046461449 8:114542421-114542443 ATGCAAAAATGAGCTGGGTATGG + Intergenic
1048114059 8:131500617-131500639 ATGAAAAAATTAACTGAAAATGG + Intergenic
1048252201 8:132876110-132876132 CTGAAAAAATGGAATGGGTGAGG + Intronic
1048523224 8:135176836-135176858 ATGAATAAATGGATTGAGAGAGG - Intergenic
1048641123 8:136363048-136363070 ATTTAAAAATGGACTGAATCTGG - Intergenic
1049816951 8:144608374-144608396 ATGGAAGGATGGACTGAGGATGG - Intergenic
1049912992 9:287731-287753 CTGAATAAATGGACTGAAAATGG - Intronic
1050008876 9:1164322-1164344 ATGAAAAAAGGGAGGGAGGAAGG - Intergenic
1050025219 9:1327219-1327241 AGGAAAAAAAACACTGAGTAGGG - Intergenic
1052412256 9:28136908-28136930 ATGAACAAAAAGGCTGAGTAAGG + Intronic
1052883663 9:33622859-33622881 AAGAAATAATGGACTGTGCAGGG + Intergenic
1053256987 9:36626004-36626026 AAGACAAAATGCACTGAATAAGG + Intronic
1055263747 9:74471990-74472012 ATGAAAAAATAGACTGTTAAGGG - Intergenic
1055835251 9:80432321-80432343 ATACAAAAAGTGACTGAGTAAGG + Intergenic
1055916464 9:81406829-81406851 CTGAAATAATGGACTGAAGAGGG + Intergenic
1056164313 9:83926677-83926699 AAGAAAAATTGGGCTGGGTATGG - Intergenic
1056462916 9:86825463-86825485 TTAAATAAGTGGACTGAGTAAGG - Intergenic
1057136205 9:92689832-92689854 AGGAAAAAATGGGCTGGGCACGG - Intergenic
1057818458 9:98313442-98313464 ATGAAAATATGGAATGGGGAAGG - Intronic
1057868988 9:98703782-98703804 ATAAAAAGATAGACTGAGTGTGG - Intronic
1058340155 9:103885804-103885826 GTGCATCAATGGACTGAGTAAGG + Intergenic
1058561592 9:106234642-106234664 ATGTTAAAATGGAATAAGTAAGG - Intergenic
1058980138 9:110161385-110161407 AGAAAAAAATGGCCTGACTATGG - Intronic
1059182351 9:112229188-112229210 ATGAAAAAATCGAGTGAGACTGG - Intronic
1059333426 9:113551945-113551967 ATGAAAAAATAGAGTTAGTGAGG - Intronic
1060331249 9:122672854-122672876 TTGAAAAAATGGAGGCAGTAAGG + Intergenic
1060339585 9:122762230-122762252 ATGAAGAAATGGACTTGGAAAGG + Intergenic
1061244648 9:129395190-129395212 ATGAAAAAATGGATGGAGGATGG + Intergenic
1061661713 9:132134683-132134705 TTGAAGCCATGGACTGAGTAAGG + Intergenic
1185807229 X:3069477-3069499 ATGTAAAAATGAACTGGGTGTGG - Intronic
1186244195 X:7603370-7603392 TTGAATCAGTGGACTGAGTAAGG - Intergenic
1186338794 X:8621208-8621230 ATGTAAAAATCAACTGAGCATGG + Intronic
1186567634 X:10680879-10680901 ATAAAAAAATGCACTGGGTGTGG + Intronic
1187628961 X:21146823-21146845 TTGAAAAAATGGAATAAGGAAGG - Intergenic
1188266186 X:28078353-28078375 ATGATAAAATGGACAGAGCCAGG - Intergenic
1188274696 X:28185293-28185315 ATGAAGAAATGAACTGATGAAGG - Intergenic
1188930375 X:36102175-36102197 ATGAAAGAATTTCCTGAGTATGG + Intronic
1189514722 X:41701626-41701648 CTGAAAACATGGACTGACTGAGG - Intronic
1190200029 X:48353467-48353489 ATTAAAAAATGAGCTGAGTGTGG + Intronic
1190255407 X:48758704-48758726 ATGAATTGTTGGACTGAGTAAGG + Intergenic
1190359150 X:49633150-49633172 AAGTACAGATGGACTGAGTATGG - Intergenic
1192106171 X:68319578-68319600 ATGCAAAAATTGGCTGAGTGTGG + Intronic
1192123954 X:68483784-68483806 ATAAAAAAATGGAATGATTGGGG + Intergenic
1193391049 X:80929678-80929700 AAGTACAGATGGACTGAGTACGG + Intergenic
1194283621 X:91983303-91983325 AAGTACAGATGGACTGAGTACGG - Intronic
1194662443 X:96641892-96641914 AAGAAAAAATCTACTGAGTGGGG - Intergenic
1195393429 X:104386569-104386591 AAGAAAAAAAGAACTGAGAAGGG + Intergenic
1196005886 X:110836761-110836783 ATGAAAAAGAGGAATGAGGAGGG + Intergenic
1196129640 X:112141272-112141294 ATGAATGAATGGGCTTAGTAAGG - Intergenic
1196271841 X:113721284-113721306 ATGAAAAAAAGAACAGAGAATGG - Intergenic
1196786321 X:119424454-119424476 ATAAAAAAAGGGCCTGAGGAAGG - Intronic
1196910875 X:120483069-120483091 ATGAAAAAATGGACAGGAAAAGG - Intergenic
1197471796 X:126872469-126872491 ATGAAAAAATCAACTGAAGATGG - Intergenic
1197507303 X:127321821-127321843 ATGAAAAAAGGGACTGAATTAGG - Intergenic
1198426724 X:136528248-136528270 ATTAAAAAATTAGCTGAGTATGG - Intergenic
1199223027 X:145339597-145339619 ACCAAAAAATAAACTGAGTAGGG + Intergenic
1199427726 X:147722341-147722363 ATCAAAGAGTGGACTAAGTAGGG - Intergenic
1200106662 X:153717567-153717589 AAGAAAAAATTAACTGAGTGTGG - Intronic
1200601194 Y:5207867-5207889 AAGTACAGATGGACTGAGTACGG - Intronic
1200900079 Y:8422288-8422310 ATAAAAAAATAGACTGAAAATGG + Intergenic
1200968888 Y:9128609-9128631 CTGAATAACTGTACTGAGTATGG - Intergenic
1200985690 Y:9302367-9302389 AGGAAAAAATGGACACAGGAAGG - Intergenic
1201144260 Y:11054493-11054515 AAGAAAAAATGGAGAGAGTGAGG + Intergenic
1201385311 Y:13434354-13434376 ATGCAAAAATTAGCTGAGTATGG - Intronic
1201463414 Y:14253734-14253756 TTCAATCAATGGACTGAGTAAGG - Intergenic
1201556892 Y:15272512-15272534 ATAAAAAAATGGAATTAGCATGG - Intergenic
1201755713 Y:17483701-17483723 ACCAAAAAATGGACTGGGTGAGG - Intergenic
1201845839 Y:18422284-18422306 ACCAAAAAATGGACTGGGTGAGG + Intergenic
1201887575 Y:18902417-18902439 CTGAAACAATGGAATGAGGAAGG + Intergenic