ID: 947166917

View in Genome Browser
Species Human (GRCh38)
Location 2:227271920-227271942
Sequence GATCTTACCTCAAAGAGGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 118}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947166913_947166917 9 Left 947166913 2:227271888-227271910 CCCAGGGCTAATCTGTGTTAGCC 0: 1
1: 0
2: 0
3: 5
4: 79
Right 947166917 2:227271920-227271942 GATCTTACCTCAAAGAGGTTTGG 0: 1
1: 0
2: 1
3: 9
4: 118
947166912_947166917 18 Left 947166912 2:227271879-227271901 CCAGTTTCTCCCAGGGCTAATCT 0: 1
1: 0
2: 1
3: 19
4: 193
Right 947166917 2:227271920-227271942 GATCTTACCTCAAAGAGGTTTGG 0: 1
1: 0
2: 1
3: 9
4: 118
947166914_947166917 8 Left 947166914 2:227271889-227271911 CCAGGGCTAATCTGTGTTAGCCA 0: 1
1: 0
2: 0
3: 5
4: 98
Right 947166917 2:227271920-227271942 GATCTTACCTCAAAGAGGTTTGG 0: 1
1: 0
2: 1
3: 9
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947166917 Original CRISPR GATCTTACCTCAAAGAGGTT TGG Intronic
905997621 1:42395285-42395307 GATCAAACCTCAAACAAGTTAGG - Intronic
907151888 1:52296676-52296698 GAACTTGCCCCAAACAGGTTTGG + Intronic
909191252 1:72555384-72555406 GATCTTACCTGCATGAGGTGAGG - Intergenic
911449384 1:98045331-98045353 GAACCTTCCTGAAAGAGGTTGGG - Intergenic
912980644 1:114368582-114368604 GCTCTTACCACAAAGAGGGAAGG + Intergenic
915328237 1:155092334-155092356 GATCTGACTCCAAAGAGGTCTGG + Intergenic
921165452 1:212503678-212503700 GATGTTACCTCAGAGAGTATGGG + Intergenic
921204004 1:212832508-212832530 AATCTTGCCTCAAAAAGCTTAGG - Intronic
922528552 1:226325373-226325395 GATCTTCCCTCAATGTGGCTGGG - Intergenic
924173656 1:241367215-241367237 GATCTTACATCACCGAGGTGGGG - Intergenic
924905292 1:248445655-248445677 GATCCTACCTCAGAGAAGCTGGG - Intergenic
1063197221 10:3754779-3754801 AACCCTGCCTCAAAGAGGTTTGG + Intergenic
1064894363 10:20217349-20217371 GAACTTACATCAAAGAAGCTGGG - Intronic
1068726830 10:60312463-60312485 GTTCCTACCTTAAAGGGGTTTGG + Intronic
1068941711 10:62687193-62687215 GATCTTCCTTCAAAGTGTTTTGG - Intergenic
1073214397 10:101828621-101828643 GTTCTTTCCTCAAGGAGGTGAGG - Exonic
1075187805 10:120278508-120278530 GATTTTATCTCAAACAGATTTGG + Intergenic
1076150444 10:128158016-128158038 GATTTTAACTCCAACAGGTTAGG - Intergenic
1077032598 11:476233-476255 GGTCTTGCCTCCAAGGGGTTTGG + Intronic
1078389209 11:10921552-10921574 CATCTGACTTCAAAGAGGGTGGG + Intergenic
1079711596 11:23690136-23690158 GCTCTTACCTCATAGAGGTAAGG + Intergenic
1080673677 11:34405060-34405082 GAAACTGCCTCAAAGAGGTTAGG - Intergenic
1083181145 11:60986436-60986458 CATTTTACCTCAGAGAGCTTTGG - Intronic
1084278069 11:68066509-68066531 GATATTACCTGCAAAAGGTTTGG + Exonic
1085832939 11:79921326-79921348 GGCCATACCTCAAGGAGGTTTGG + Intergenic
1089171802 11:116517143-116517165 TCTCTTACCTCTAAGAGGTATGG - Intergenic
1090053282 11:123399937-123399959 GATATTACCTCACACAAGTTAGG - Intergenic
1090884865 11:130866944-130866966 GAGCTTTCCTCACAGAGATTGGG - Intergenic
1093354687 12:18152339-18152361 GATCTGACATGAAAGAGCTTTGG - Intronic
1094067221 12:26374084-26374106 GATCTTACCACAAAGAGGTGTGG - Intronic
1094325352 12:29232023-29232045 GAACATATCTCAAAGGGGTTGGG + Intronic
1095841365 12:46697319-46697341 GATCTTTCCTTCAAGAGGGTTGG + Intergenic
1100068279 12:90678472-90678494 GGTCTTACCTCATAGAGTTTTGG + Intergenic
1101171452 12:102100541-102100563 GATATTAGCACAAAGAGATTAGG + Intronic
1101739212 12:107487249-107487271 GTTCCTGCCTCAAAGAAGTTGGG + Intronic
1108982155 13:56528548-56528570 GACCATACCTCAAAGAGTTCAGG - Intergenic
1109441022 13:62374671-62374693 GATCTTACCTCAGAGGTGTATGG + Intergenic
1109703853 13:66062843-66062865 GATATTACCTCACAGCTGTTAGG + Intergenic
1111088199 13:83404745-83404767 GGTCTTTCCTCAGAGAGATTTGG - Intergenic
1111117030 13:83793022-83793044 AATCTTCCCTCCTAGAGGTTAGG + Intergenic
1111518661 13:89368554-89368576 GATATTACCTCAAAGAGAGAGGG - Intergenic
1111678800 13:91418834-91418856 GATTCTACCTCAAATAAGTTTGG - Intronic
1114878938 14:26759768-26759790 GATATTACCTCAAACCTGTTAGG + Intergenic
1119196143 14:72718001-72718023 GATCCTACCTCCAAGGGGTTTGG + Intronic
1119609729 14:76051615-76051637 AAATTTACCTCAATGAGGTTTGG + Intronic
1120239428 14:81932983-81933005 AATCTTACCTACAAAAGGTTGGG + Intergenic
1121969105 14:98340206-98340228 GATCTTCCCTCAAAGTGGGCGGG + Intergenic
1124923160 15:34046268-34046290 GATCTTTCCACAAAAAGATTTGG - Intronic
1125671131 15:41473569-41473591 GATCCTATCTCAAACAGGCTGGG - Intronic
1127716817 15:61656314-61656336 AATCTAACTTCAAAGAGGATTGG - Intergenic
1137546662 16:49409341-49409363 GTTCTCACCTCAAAGAGCATGGG + Intergenic
1143307333 17:5957909-5957931 TAGCTTACCTCAAAGAAATTTGG - Intronic
1144144638 17:12385377-12385399 TATCTGCCCTCAAAAAGGTTAGG - Intergenic
1144614781 17:16758894-16758916 GTGCTTATCTCAAAGAGATTGGG - Intronic
1144897924 17:18556780-18556802 GTGCTTATCTCAAAGAGATTGGG + Intergenic
1145134446 17:20388934-20388956 GTGCTTATCTCAAAGAGATTGGG - Intergenic
1148703625 17:49608452-49608474 GATATTGCCCCAAAGAGGTGGGG + Intronic
1151701414 17:75744505-75744527 GAGTTTATCTCCAAGAGGTTTGG - Intronic
1158682678 18:59582682-59582704 GATAGTAACTGAAAGAGGTTGGG - Intronic
1159103412 18:63979682-63979704 GATCCTACTTTAAAAAGGTTTGG - Intronic
1159744821 18:72219680-72219702 GTTCTTTCTTCTAAGAGGTTTGG + Intergenic
1164150902 19:22550228-22550250 GATATTACCTCACACATGTTAGG + Intergenic
929247462 2:39718609-39718631 GCACTTACCTCATAGAGCTTTGG - Intergenic
929877884 2:45812119-45812141 GATCTTTACTCAGAGAGGTGGGG - Intronic
933622198 2:84555831-84555853 GATCTGATCTCAAGGAGGTAAGG - Intronic
937565206 2:123277246-123277268 GACCTTACCCCAAAGGGATTGGG + Intergenic
940619039 2:156087550-156087572 CTTTTTACCTCAAAGAGTTTGGG - Intergenic
941087002 2:161129737-161129759 GAACTCCCCTCAAAGAGGTAAGG - Intergenic
942530303 2:176902827-176902849 GAGTCTACCTCAATGAGGTTTGG + Intergenic
943572035 2:189584907-189584929 GATCATACCACTAAGAGGTTGGG - Intergenic
947166917 2:227271920-227271942 GATCTTACCTCAAAGAGGTTTGG + Intronic
947702340 2:232244852-232244874 GTTCTTACCTCCATGAGGGTTGG - Intronic
948324082 2:237097503-237097525 AATCTTACATCATAGAGGCTTGG - Intronic
1175469765 20:59219228-59219250 GCCCTCACCTCAAGGAGGTTAGG + Intronic
1176018566 20:62951391-62951413 GGTGTTACTTCAAATAGGTTGGG - Intergenic
1176890254 21:14308032-14308054 AATTATACCTCAAAGAAGTTGGG + Intergenic
1178072762 21:28987526-28987548 AATTTTAGCCCAAAGAGGTTAGG - Intronic
1178142755 21:29702361-29702383 GATCTTATGGCAGAGAGGTTGGG + Intronic
1179141296 21:38727725-38727747 GAGCTGACGTCAAAGAGGTAAGG - Intergenic
1180931689 22:19596647-19596669 GATCTTACTTTAAAGAGTTGAGG - Intergenic
1182446046 22:30390257-30390279 GATGTTACCTCAACGTGGGTGGG + Intronic
1184956466 22:47890125-47890147 GACCTTAGCTCAAAGAGAGTGGG - Intergenic
949179603 3:1112604-1112626 GATCTGTCCTCAAAGTGGGTGGG - Intronic
951437048 3:22676832-22676854 GATCTTCCCTGCATGAGGTTGGG + Intergenic
952186525 3:30975578-30975600 GATCTTCTCTCAATGAGGGTGGG + Intergenic
953789075 3:45932579-45932601 GAATTAACTTCAAAGAGGTTAGG + Intronic
954909151 3:54088277-54088299 GCCCTCACCTCTAAGAGGTTTGG - Intergenic
964054240 3:152433207-152433229 GCGCTTACCTCAAAGAGTTAGGG + Intronic
965478781 3:169190750-169190772 GATTTTAACTCAGAGAAGTTTGG + Intronic
965598449 3:170431397-170431419 CATCTCAACTTAAAGAGGTTTGG + Intronic
973312742 4:48727246-48727268 GATCTGACCTGAAAGAAGCTTGG + Intronic
974080795 4:57210306-57210328 GTTCCTACCTCAGAGAGCTTGGG - Intergenic
974090497 4:57305669-57305691 GCTCTTACTTCAAAGATGTTTGG - Intergenic
975646405 4:76550323-76550345 TTTCTGACCTCAAAGAGTTTAGG + Intronic
976571416 4:86616355-86616377 GATGTTACCTCATAGAGATGAGG + Intronic
977474960 4:97494094-97494116 AAGCTTATCTCAAAGAGATTTGG + Intronic
984749013 4:183253624-183253646 GACCTTACCAGAAAGAGGTGTGG - Intronic
984973699 4:185211081-185211103 TATCTTACCCCAAAGCGCTTGGG - Intronic
991310410 5:65234553-65234575 GATATTACCTCACACATGTTAGG + Intronic
994689805 5:103003455-103003477 GTTCTCACCTCAAAAATGTTAGG + Intronic
995609511 5:113893947-113893969 CATCTTACTTCAAAGAGGAAAGG - Intergenic
999647620 5:153734852-153734874 GATCTTATCTTAAAGATGATGGG + Intronic
999787983 5:154909595-154909617 TATCTTACTACAAAGAGGCTTGG - Intronic
1012001399 6:93659515-93659537 GGTCTTTCCTCAAAGAGGACTGG - Intergenic
1013281319 6:108639593-108639615 GACCCTGCCTCAAACAGGTTTGG + Intronic
1014615632 6:123595448-123595470 GAACTTACCATAAAGAGATTTGG + Intronic
1017423711 6:154299057-154299079 GATGTTAACCCAAAGAGTTTAGG + Intronic
1018195359 6:161351750-161351772 GCTCTTATCTCAAAGTGCTTTGG - Intronic
1027931341 7:84538735-84538757 AATCTTAGCTTAAAGAGGGTTGG + Intergenic
1030661926 7:112228923-112228945 AATCTTACCTCACAGAGTTTTGG + Intronic
1032130507 7:129224310-129224332 GATCATTCCTCAAAGAAGTTAGG - Intergenic
1032818919 7:135506143-135506165 TATGTTACCTCAAAGATATTAGG - Intronic
1033231977 7:139606070-139606092 CATTTTACCTCAAAGAGATAGGG + Intronic
1039012236 8:33106451-33106473 GCACTTATCTCAAAGAAGTTAGG + Intergenic
1039151703 8:34513851-34513873 CATCTTAACTCTAAGAGGTTAGG - Intergenic
1041282910 8:56229573-56229595 GATTTTTCTTCAAAGATGTTTGG - Intergenic
1042981570 8:74535227-74535249 TATCTTCCCTTCAAGAGGTTTGG - Intergenic
1044306016 8:90642339-90642361 GGGCGTACCTCAAAGAAGTTAGG - Intronic
1045924372 8:107568667-107568689 GATCTTTCCTCCAAGATATTAGG - Intergenic
1049030013 8:140028052-140028074 GTTTTTATCTCAAAGAGGTAAGG - Intronic
1052000510 9:23273211-23273233 GAGTTTACTTCAAAGAAGTTTGG + Intergenic
1054996297 9:71394647-71394669 GATCATACATCAAAAAGGCTGGG - Intronic
1058593312 9:106588191-106588213 CATTGTACCTCACAGAGGTTAGG - Intergenic
1186021543 X:5262346-5262368 TTTCTTACCTTAAAGACGTTAGG - Intergenic
1188868419 X:35343880-35343902 GATTTTAGCTCACAGAGGATAGG + Intergenic
1190009648 X:46773336-46773358 GATATTACCTCACACTGGTTAGG + Intergenic
1195808267 X:108800091-108800113 GATATTACCTCATACATGTTAGG - Intergenic
1198284499 X:135176467-135176489 GAACATACCTCACAGTGGTTAGG - Intergenic
1201330317 Y:12812100-12812122 GAACTTACCTTAAAGAGGCTGGG - Intronic