ID: 947168435

View in Genome Browser
Species Human (GRCh38)
Location 2:227286553-227286575
Sequence TTACATACGGGGAAATAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 81}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947168426_947168435 14 Left 947168426 2:227286516-227286538 CCCTAGGAGTAGGTACTACTATT 0: 1
1: 0
2: 8
3: 54
4: 346
Right 947168435 2:227286553-227286575 TTACATACGGGGAAATAGGGAGG 0: 1
1: 0
2: 0
3: 9
4: 81
947168427_947168435 13 Left 947168427 2:227286517-227286539 CCTAGGAGTAGGTACTACTATTG 0: 1
1: 0
2: 5
3: 25
4: 185
Right 947168435 2:227286553-227286575 TTACATACGGGGAAATAGGGAGG 0: 1
1: 0
2: 0
3: 9
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947168435 Original CRISPR TTACATACGGGGAAATAGGG AGG Intronic
910036949 1:82800255-82800277 TTACATACGGAGAAAAACTGTGG - Intergenic
912492129 1:110068269-110068291 TTAAAAACCGGGAAATAAGGCGG + Intronic
919200661 1:194351312-194351334 TGAAATAAGGGAAAATAGGGAGG - Intergenic
921633391 1:217462571-217462593 TTACATAGGAGGAAATAGAAGGG - Intronic
922778198 1:228227250-228227272 TTACAGACAGGGAAACAGGCTGG - Intronic
1063204536 10:3818531-3818553 TCACATCAGGGGAAATGGGGTGG + Intergenic
1064084369 10:12334161-12334183 TTACTTCCTGGGAAATAGGCCGG + Intergenic
1067445519 10:46341225-46341247 TTCCACACGGTGAAAGAGGGAGG + Intergenic
1067874510 10:49992712-49992734 TTCCACACGGTGAAAGAGGGAGG + Intronic
1075056863 10:119225476-119225498 TCACATACGGGGGAAGAGGTTGG + Intronic
1081628374 11:44669910-44669932 TTACAAATGGGGAAATGAGGAGG + Intergenic
1081752564 11:45522346-45522368 TTACATGGGGAGAAATATGGGGG + Intergenic
1094354853 12:29566389-29566411 TCACTTACGGGGAAAGTGGGCGG - Intronic
1102394769 12:112576117-112576139 TTACAGACAGGGAAACAGGTAGG + Intronic
1107200043 13:37704194-37704216 TTGCCTACGGGGGAATGGGGAGG + Intronic
1107954628 13:45499002-45499024 TTCCTTAAGGGGAAAGAGGGTGG + Intronic
1114215660 14:20655941-20655963 GAACATTGGGGGAAATAGGGAGG + Intergenic
1114646053 14:24256764-24256786 TTACAGACGGGGAAACAGCAAGG + Intronic
1115442389 14:33451245-33451267 TAACATAAGGGGAAATATGGGGG - Intronic
1119818599 14:77593853-77593875 TTAGAGATGGGGAAAGAGGGAGG - Intronic
1123462295 15:20484157-20484179 CTACCTACGGGGAAATGGGGAGG + Intergenic
1123655764 15:22516237-22516259 CTACCTACGGGGAAATGGGGAGG - Intergenic
1124272984 15:28300155-28300177 CTACCTACGGGGAAATGGGGAGG + Intronic
1124309674 15:28611414-28611436 CTACCTACGGGGAAATGGGGAGG - Intergenic
1124850081 15:33328232-33328254 CTACATAGGTGGAAATAGGATGG - Intronic
1125505261 15:40264407-40264429 TTAAAAATGGGGAAAGAGGGAGG - Intronic
1133880784 16:9779671-9779693 TTCCATAGAGGGTAATAGGGTGG + Intronic
1137260165 16:46820073-46820095 TAACATGCAGAGAAATAGGGAGG - Intronic
1140789509 16:78377655-78377677 TTGCATAGAGGGAAATAGGAAGG + Intronic
1146885618 17:36468918-36468940 TTACACACTAGGAAGTAGGGAGG + Intergenic
1148817229 17:50337910-50337932 TTATATGCGGTGAAATTGGGAGG + Intergenic
1149331268 17:55584753-55584775 TTAGATACGAGGAAAAAGTGGGG - Intergenic
1150900009 17:69263401-69263423 TTACATACGGTGAAAGGTGGAGG + Intronic
1155541649 18:26874338-26874360 TTATATGCTTGGAAATAGGGAGG - Intergenic
1157229141 18:45897654-45897676 TAACATACGGGAAAATAAGTTGG + Intronic
1157755998 18:50218345-50218367 TTAGATGCGGGGAAATGGTGGGG + Intergenic
1158402027 18:57129738-57129760 TTCCATATGGGAAAATGGGGAGG - Intergenic
1163480808 19:17555364-17555386 TTATACATGGGGAAATTGGGCGG + Intergenic
926145641 2:10395780-10395802 TGACAGACGGGGAAAAATGGAGG - Intronic
929352767 2:40979815-40979837 TTAATCACTGGGAAATAGGGAGG + Intergenic
930927335 2:56834530-56834552 TTAAATAAGGGGATATAAGGTGG - Intergenic
931608691 2:64076970-64076992 GGAAATATGGGGAAATAGGGTGG + Intergenic
945440851 2:209877790-209877812 TTCCATACTGGCAAATATGGTGG + Intronic
947168435 2:227286553-227286575 TTACATACGGGGAAATAGGGAGG + Intronic
948255595 2:236566233-236566255 TTACAGACAGGGAAGGAGGGAGG + Intergenic
1170953986 20:20961809-20961831 TTGCCTACTGGGAAAAAGGGGGG + Intergenic
1171963355 20:31511545-31511567 TAACATACGCAGAAATAGGCTGG - Intergenic
1175644101 20:60656795-60656817 TTACAGACGGGGCCATTGGGAGG + Intergenic
1177675886 21:24297762-24297784 TTACATAAGAGGAAATTAGGCGG + Intergenic
1183945793 22:41325060-41325082 TTACATGAGGGGAAGGAGGGAGG - Intronic
956200121 3:66697062-66697084 TTAGAAATGGGGAAATAGGCCGG + Intergenic
956788408 3:72661528-72661550 TTACAGATGGGGAAATTGAGAGG - Intergenic
959602617 3:108205154-108205176 TTTCAGACGGGGAAATATGGAGG + Intronic
967764611 3:193264807-193264829 TTAAAAACGGGCAAATAGGCTGG - Intronic
969859354 4:10023425-10023447 TTACAGATGAGGAAACAGGGAGG - Intronic
973907898 4:55548763-55548785 TTAAATACAGTGAAAGAGGGAGG - Intergenic
975264961 4:72352755-72352777 TTAGACATGGAGAAATAGGGTGG + Intronic
975611106 4:76204448-76204470 TTACATACAGGACAATATGGTGG + Intronic
979047997 4:115894232-115894254 TTATATACAGAGAAATATGGGGG + Intergenic
979716099 4:123840497-123840519 TTACAGATGAGGAAATGGGGAGG + Intergenic
981189611 4:141846634-141846656 TTACATACTGGTAAAAAAGGAGG + Intergenic
983123279 4:163915856-163915878 TTACATACTAGGAAACAGTGAGG - Intronic
983135534 4:164074972-164074994 TTACAAACAGGGAAATTGGTTGG - Intronic
983238117 4:165203116-165203138 TCAGATACGGGGTAATGGGGAGG + Intronic
984170724 4:176356321-176356343 TTAAATAGGGGGAAAAAGGGAGG - Intergenic
988694530 5:33607726-33607748 ATACATACGGCTAACTAGGGAGG - Intronic
993621103 5:90168636-90168658 TGGCATAGGGGGAAATAAGGTGG + Intergenic
994176552 5:96718134-96718156 TTACAGATGAGGAAATACGGAGG + Intronic
998373275 5:141674568-141674590 TTTCAAACAGGGGAATAGGGAGG + Intronic
1002345856 5:178547136-178547158 TTCCCTACGGGGAAATAGTTTGG - Intronic
1007413188 6:41676968-41676990 ATACATAGGAGGAAATATGGGGG + Intergenic
1009445039 6:63732719-63732741 TTGCCTATGGTGAAATAGGGAGG - Intronic
1013965988 6:115956051-115956073 ATACATTTGGGGAAAAAGGGAGG - Intronic
1021116021 7:16747498-16747520 GTCCATGAGGGGAAATAGGGAGG - Intergenic
1032774787 7:135100873-135100895 TTACATAAGGGGAATCAGAGAGG - Intronic
1033385209 7:140867176-140867198 TTACAGATGAGGAAACAGGGAGG + Intronic
1034301849 7:150023040-150023062 TAACCTTCGGGGAAATAGGGTGG - Intergenic
1034515592 7:151575953-151575975 TTACATACTGGGTAAGAAGGTGG - Intronic
1034804196 7:154074221-154074243 TAACCTTCGGGGAAATAGGGTGG + Intronic
1039125766 8:34199909-34199931 TCACATAAGGGGAAAGAGGAAGG - Intergenic
1043782889 8:84359137-84359159 TTACATACTGTGAAATAATGGGG - Intronic
1047326523 8:123843056-123843078 TTCTATACAGGGAAACAGGGAGG - Intergenic
1057429104 9:94978089-94978111 TTGCAGACGGGGAAGTAGTGAGG - Intronic
1060206724 9:121686687-121686709 TTACAGACAGGGAAAGAGAGTGG - Intronic
1189807022 X:44745735-44745757 TTTACTACGGGGAAATATGGAGG + Intergenic
1190927308 X:54921508-54921530 TTGCAGACGTGGAAAGAGGGGGG + Intronic
1192233215 X:69279862-69279884 TTGCATACGGGGAAGTGAGGAGG - Intergenic
1192808077 X:74527414-74527436 TTACATGCAGGGAGAAAGGGGGG - Intronic
1195645330 X:107224823-107224845 TTACATCAGGGTAAATGGGGTGG - Intronic
1198465650 X:136902488-136902510 TTAGATTGGGGGAAATTGGGAGG + Intergenic
1200058875 X:153475191-153475213 TTTCACACGGGCAAAGAGGGTGG + Intronic