ID: 947169104

View in Genome Browser
Species Human (GRCh38)
Location 2:227293243-227293265
Sequence CTGGCCCACCTGGACATTTG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 139}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947169094_947169104 14 Left 947169094 2:227293206-227293228 CCGGGTGATATGGGAAAGAAAGG 0: 1
1: 0
2: 2
3: 25
4: 272
Right 947169104 2:227293243-227293265 CTGGCCCACCTGGACATTTGGGG 0: 1
1: 0
2: 0
3: 16
4: 139
947169092_947169104 23 Left 947169092 2:227293197-227293219 CCAGGACTGCCGGGTGATATGGG 0: 1
1: 0
2: 0
3: 5
4: 94
Right 947169104 2:227293243-227293265 CTGGCCCACCTGGACATTTGGGG 0: 1
1: 0
2: 0
3: 16
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947169104 Original CRISPR CTGGCCCACCTGGACATTTG GGG Exonic
901938863 1:12646627-12646649 CTGGGCCACCTGAACATCTTAGG - Intronic
903029119 1:20450256-20450278 CTGCCCCTCCTGCACCTTTGCGG - Intergenic
903328433 1:22584737-22584759 TTGGCCCACCTGAACCTCTGGGG + Intronic
906292397 1:44627800-44627822 CTGGCACACCTGACCCTTTGTGG + Intronic
906798144 1:48713630-48713652 CTGGATCATGTGGACATTTGAGG + Intronic
910824738 1:91393855-91393877 GTGTCCCACCTGGACTGTTGTGG + Intronic
912036852 1:105327035-105327057 CTGGCCCAAATGAACACTTGAGG - Intergenic
913200560 1:116492709-116492731 CTGGCCCAGATGGACTTCTGTGG - Intergenic
914394061 1:147247955-147247977 CAGGCCCACCTGGATAATTCAGG + Intronic
918766131 1:188486318-188486340 CTGGCCCACCTAGACAACTTAGG + Intergenic
919799777 1:201346631-201346653 CTTGCCCACCTGGAGAATGGTGG - Intergenic
921568982 1:216755942-216755964 CTGGCCCCCCTGCACATTACAGG + Intronic
922802424 1:228370524-228370546 CTGCCCCACCTGGACATCTTGGG + Intronic
1064635891 10:17366680-17366702 CTGGGTCACCTGTAGATTTGGGG - Intronic
1065198937 10:23295323-23295345 CTGGCCCAGCTGGACATTCTGGG - Intronic
1065839252 10:29687393-29687415 CTGGCCAAACTTGACATTTTTGG - Intronic
1067926571 10:50514482-50514504 AGGGCCCACCTGGACAATTCAGG + Intronic
1068885260 10:62091397-62091419 CTGGACCACAAGGACCTTTGGGG - Exonic
1069728506 10:70596411-70596433 CTGTCCCACCTGGGGATTTAGGG + Intergenic
1073035222 10:100560165-100560187 CTGGCCCACATAGATATTTGAGG + Intergenic
1073095750 10:100978723-100978745 CAGGCTCACCTGGGGATTTGGGG - Intronic
1073303406 10:102484698-102484720 CTGGCCCCTGTTGACATTTGAGG - Intronic
1074048833 10:109864618-109864640 CTGGCCTCCCCGCACATTTGGGG - Intergenic
1075765554 10:124890310-124890332 CTGGTCATCCTGGAGATTTGTGG - Intergenic
1076677375 10:132154070-132154092 CTGGCCCACATGGGCACCTGAGG - Intronic
1077400175 11:2351741-2351763 CAGGACCACCTGGAGACTTGGGG - Intergenic
1078024347 11:7680454-7680476 CAGGCCCACCCGGATAATTGAGG - Intergenic
1080046542 11:27814477-27814499 CTGGACCACCTGGCCATTTTGGG - Intergenic
1083294447 11:61707599-61707621 CGGGCTTACCTGGTCATTTGTGG + Intronic
1086501168 11:87455389-87455411 CTGGCTCACCTGGTCAGTGGTGG + Intergenic
1087896929 11:103596473-103596495 CTGAGCCACCTGGATAATTGTGG - Intergenic
1089959149 11:122600214-122600236 ATGGCAGACCTGGGCATTTGGGG + Intergenic
1097050084 12:56217616-56217638 CTGGTCCATCTGGGGATTTGGGG - Intronic
1103511826 12:121480136-121480158 CCCGCCTCCCTGGACATTTGTGG - Intronic
1107161047 13:37228356-37228378 TTGGCCCACCTGGATAATTCAGG + Intergenic
1124132259 15:27001337-27001359 CTGGCCCACCTGGGCCTCAGAGG - Intronic
1125484034 15:40100152-40100174 GTGGCCCATCATGACATTTGGGG - Intronic
1125790727 15:42363655-42363677 CTGGGCCACCTGGTAATGTGTGG + Intronic
1126415359 15:48412560-48412582 CTGACCCACCTCGATATTGGAGG + Exonic
1131258665 15:90877327-90877349 CTGGCCCACCTGGGGCTCTGAGG + Intronic
1131259686 15:90882018-90882040 CGGGCCCACCTGGCCACCTGAGG + Exonic
1133224177 16:4332776-4332798 CTGGCCAACCTGGGCAGTAGAGG + Intronic
1139545506 16:67647899-67647921 CTGACCCACCTGGACCTTTCTGG + Exonic
1139740209 16:69028917-69028939 CTGGTCCACTTGGAGATCTGGGG - Intronic
1140426338 16:74864837-74864859 GAGGCCCAGCTGGACACTTGAGG + Intergenic
1143594529 17:7906436-7906458 CTGGAGCACCTGGGGATTTGGGG + Intronic
1143761267 17:9105801-9105823 CCAGCTCACCTGCACATTTGGGG - Intronic
1146054411 17:29574007-29574029 CTGGTCCATCTGGAGTTTTGAGG - Exonic
1148212926 17:45819043-45819065 CTTGCCCCCCTTGACATGTGGGG - Intronic
1149431245 17:56596626-56596648 CTGGCCCACGTGGAGCTGTGAGG - Intergenic
1151433454 17:74080238-74080260 CTGCCCCACCTTGGCATTTTTGG - Intergenic
1153750676 18:8227001-8227023 CTGGCCCACTTGGATAATTTAGG + Intronic
1153966361 18:10186242-10186264 CTGGCCCAGTTGGACATCTGAGG + Intergenic
1155497953 18:26461088-26461110 CTAGCCCATCTGGACATCAGGGG - Intronic
1155711351 18:28884321-28884343 TTGGCCAACCTGCATATTTGGGG + Intergenic
1156787303 18:40931234-40931256 CCTACCCACCTGGATATTTGAGG + Intergenic
1158514501 18:58119836-58119858 CTGGCAGGCCTGGACATTGGCGG + Intronic
1159105290 18:63997293-63997315 CACACCCACCTGGATATTTGAGG - Intronic
1160354607 18:78216379-78216401 CAGGGCCGCCTGAACATTTGTGG + Intergenic
1161697543 19:5777910-5777932 CTGGCCCACTTTGACTTTTATGG - Intronic
1164733430 19:30523050-30523072 CTGCCCCAACTGGACTTTTCAGG + Intronic
1166271891 19:41719594-41719616 CTGGCCAACCTGGGGACTTGTGG - Intronic
1168542107 19:57221343-57221365 CTGGCCTACCTGGGCTTTTTTGG + Exonic
925122110 2:1427427-1427449 CTGGGCCACCTGGCCAGGTGTGG + Intronic
925779856 2:7372221-7372243 AAGACCCACCTGCACATTTGCGG - Intergenic
927208541 2:20624930-20624952 CCGGACCACCTGGACACTTGTGG - Intronic
929024328 2:37585239-37585261 CTGTTCCACCTGAAGATTTGAGG - Intergenic
929175254 2:38969277-38969299 CTGGCCCATTTGGACCTGTGAGG - Intronic
931624466 2:64244328-64244350 CAGGCCCACCCTAACATTTGTGG + Intergenic
934477300 2:94602196-94602218 CAGGCCCACCTGAAGTTTTGGGG - Intronic
937440807 2:121914073-121914095 CTGACCCACATGGATCTTTGGGG - Intergenic
941756465 2:169191777-169191799 CCAGCCCCCATGGACATTTGAGG + Intronic
944671112 2:201995408-201995430 CTGGCCCACCTGAGCTCTTGGGG - Intergenic
944985119 2:205167327-205167349 CTGGCCCAAATGTACAATTGTGG + Intronic
947169104 2:227293243-227293265 CTGGCCCACCTGGACATTTGGGG + Exonic
947679966 2:232021667-232021689 TTGACCCACCTGTAAATTTGAGG + Intronic
947972975 2:234339507-234339529 CCTCCCCGCCTGGACATTTGGGG + Intergenic
949058882 2:241945117-241945139 ATGGCCCACCTCCACATTGGAGG - Intergenic
1169288191 20:4327177-4327199 GTGGCCCACCAGGCCATTGGAGG + Intergenic
1171267386 20:23782770-23782792 CTGGGCTACCTGGGCATGTGGGG + Intergenic
1171280244 20:23890083-23890105 CTGGGCTACCTGGGCATGTGGGG + Intergenic
1174400541 20:50273608-50273630 CTCGCTCGCCTGGACATCTGCGG - Intergenic
1175070152 20:56326157-56326179 CTGGGCCATCTGGGCATATGGGG + Intergenic
1176063806 20:63183818-63183840 CAGGCCCACCTGGACCTTGGTGG - Intergenic
1176673274 21:9753540-9753562 TTCGCACACCTGGACATTTCTGG - Intergenic
1179334820 21:40440920-40440942 ATGGACCACCTGGAGCTTTGAGG + Intronic
1180096604 21:45558254-45558276 GTGGCCCACCTGGACTTGGGGGG - Intergenic
1181728524 22:24827993-24828015 CCTGACCACCTGGACCTTTGTGG + Intronic
1183079385 22:35446904-35446926 GTGACCCACCTGGGCAGTTGGGG - Intergenic
951599359 3:24356262-24356284 CAGGACCACCTGGAGTTTTGGGG - Intronic
951612603 3:24507953-24507975 CTGGCCCCTGGGGACATTTGTGG - Intergenic
952894494 3:38068703-38068725 CTGATACACCTGGACATATGGGG + Intronic
952949889 3:38514465-38514487 CTGGAGCACTTGGACATTAGCGG + Intronic
953772842 3:45792141-45792163 ATGGCTCACCTTGACATTGGAGG - Intronic
961482735 3:127194676-127194698 ATGGCCCACCCAGAAATTTGAGG - Intronic
961504577 3:127361547-127361569 CCGGACCACAGGGACATTTGGGG + Intergenic
961777933 3:129303189-129303211 CTGGCCCCCACTGACATTTGGGG + Intronic
961920122 3:130416791-130416813 CTGGAAGACCTGGACTTTTGGGG + Exonic
962585941 3:136842907-136842929 CTGGCACACCTCGAAATTTCTGG - Intronic
966264462 3:178022376-178022398 CTGGCACACCTGGATAATTCAGG + Intergenic
966934611 3:184697773-184697795 CTGGCCCTCCTCTACCTTTGTGG + Intergenic
967973121 3:195013632-195013654 CTGTCCTCCCTGGACGTTTGCGG + Intergenic
968085620 3:195872672-195872694 CTGACCCACCTAGAGAGTTGTGG - Intronic
969223111 4:5774162-5774184 CTGGGCCACCTGCCCATTTCTGG + Intronic
969939555 4:10717107-10717129 CTACCCCAGCTGGGCATTTGGGG - Intergenic
971286297 4:25293081-25293103 TTGACCAAGCTGGACATTTGTGG - Intergenic
975908337 4:79242226-79242248 GTGGCCCACCTGCACCTTGGAGG + Intronic
977712983 4:100148867-100148889 CTGGCCCAGCTGGACATAAAAGG + Intergenic
980106558 4:128594066-128594088 AGGGCCCACCTGGACAATTCAGG + Intergenic
982436456 4:155386590-155386612 CTGGTACACCTGGCCAGTTGTGG + Intergenic
986303999 5:6501935-6501957 CTAGACCACCTGGACACCTGAGG - Intergenic
988670567 5:33376643-33376665 CTGGCCCACCTGTAAATAGGTGG + Intergenic
991469993 5:66957723-66957745 CTGGCCCATATGCACCTTTGTGG + Intronic
992075781 5:73191534-73191556 CTGGCTCACCAGGACAGTTTCGG - Intergenic
993639456 5:90383894-90383916 GTTGCCCACCTGTACAATTGGGG + Intergenic
999538080 5:152540669-152540691 ATGACCCACCTGCACATTTCTGG - Intergenic
1000642457 5:163718699-163718721 GTGGCCCAACTGGGCATTTGGGG - Intergenic
1002584058 5:180230338-180230360 CTCTCCCAGCTTGACATTTGTGG - Intergenic
1003675594 6:8201700-8201722 CTCGCTCACTTGGACATTTCTGG - Intergenic
1006207029 6:32355760-32355782 CTTGCCTAACTGGATATTTGAGG - Intronic
1007831803 6:44644722-44644744 CTGGCCCTGGTGAACATTTGTGG - Intergenic
1014699714 6:124669527-124669549 CTGGCCCATGTGGATATTTGCGG + Intronic
1015841933 6:137486619-137486641 CGGCCCCAGCTGTACATTTGGGG + Intergenic
1018790253 6:167142997-167143019 CTGCCCCACCTGGACACCTGGGG - Intergenic
1018948762 6:168364967-168364989 CTGGCCATGCTGGACGTTTGAGG - Intergenic
1019201594 6:170320840-170320862 CTTGCCCCCTTGGACTTTTGTGG - Intronic
1024981162 7:55158805-55158827 CTGGCCTCCCTGGGCATATGTGG + Intronic
1026134373 7:67646577-67646599 CTGGTCCACGTGGCCATTGGAGG + Intergenic
1026837972 7:73650628-73650650 CTGACCCACCAGGACGTATGAGG - Intergenic
1027513001 7:79107125-79107147 TGGGCCCACCTGGATATTTGAGG - Intronic
1035554204 8:553387-553409 CTGGCCCACCTAGCCCATTGGGG - Intergenic
1039992107 8:42497333-42497355 CTGGTGCACGTTGACATTTGAGG - Intronic
1040384181 8:46902203-46902225 CTGGCCCATCTGAACATCTAAGG - Intergenic
1042612671 8:70615404-70615426 ATGGCACACCTGGAGCTTTGGGG + Intronic
1044828354 8:96220316-96220338 CTGGCCCACTTGGAGAATTTAGG - Intergenic
1045494142 8:102694014-102694036 CTGGCCCACATGGCCCTGTGTGG - Intergenic
1046070973 8:109252702-109252724 CTGGTTCACCTGAACATTGGAGG - Intronic
1048399309 8:134049058-134049080 CTGGCACACTGGGACATTTGGGG + Intergenic
1048643927 8:136396432-136396454 AGGGCCCACCTGGACAATTGTGG - Intergenic
1051669496 9:19495368-19495390 CTCTCCCACCTGGACACTTGTGG - Intergenic
1052852670 9:33387366-33387388 CAGGCCCACCTGAAGTTTTGGGG + Intronic
1053025099 9:34723088-34723110 CTGTCCCACCTGCACATTTATGG + Exonic
1053680769 9:40483917-40483939 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1053930755 9:43112229-43112251 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054282944 9:63141018-63141040 CAGGCCCACCTGAAGTTTTGGGG - Intergenic
1054293851 9:63319432-63319454 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054391876 9:64623921-64623943 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054503853 9:65892407-65892429 CAGGCCCACCTGAAGTTTTGGGG - Intronic
1058313304 9:103533287-103533309 GTGGCCCACCTGGCTATTAGTGG - Intergenic
1062081979 9:134629134-134629156 CAGCCCCACATGGACATGTGTGG + Intergenic
1186610193 X:11131336-11131358 CTTCCCCTACTGGACATTTGAGG + Intergenic
1186884298 X:13897740-13897762 CGAGCCCATCTGGACATTTTTGG - Intronic
1192312969 X:70031782-70031804 CTGGCCTCCCTGGACAGGTGGGG - Intronic
1196745866 X:119071186-119071208 CTGGCCCACCTTGACCTTGATGG + Intergenic
1199425685 X:147698439-147698461 TTGGCCCACCTGGATAATTCAGG - Intergenic
1199691302 X:150310920-150310942 CTGGCCAATGTGGACAATTGGGG + Intergenic