ID: 947170013

View in Genome Browser
Species Human (GRCh38)
Location 2:227301379-227301401
Sequence CTCATCAGTGATGCGTAATG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 69
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 63}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947170013 Original CRISPR CTCATCAGTGATGCGTAATG AGG Intronic
908834149 1:68211705-68211727 CTCATGAGTGGTGAGAAATGGGG - Intronic
909542957 1:76811321-76811343 CCCATCAGTCATGCCTAATTAGG - Intergenic
911269404 1:95782131-95782153 TTCCTCAGTGATGTGTAATATGG + Intergenic
912695408 1:111838002-111838024 CTCGACAGTGACGCGTTATGTGG - Intronic
917380537 1:174401412-174401434 CTCACCCGTGATGGGGAATGAGG + Intronic
922857307 1:228785915-228785937 CTGAACAGTGATGCGTGGTGTGG - Intergenic
1066350027 10:34628682-34628704 CCCATCAGTGCTGCGCAGTGTGG - Intronic
1072475784 10:95758537-95758559 CTCATCAGTTATGCCTAAGGTGG + Intronic
1076409561 10:130236191-130236213 CTTATCCGTGATGGGTAATGGGG + Intergenic
1078459115 11:11499829-11499851 CTCACAGGTGATGGGTAATGTGG + Intronic
1081592365 11:44433423-44433445 CTCATCAATGAAGCATATTGGGG + Intergenic
1089163602 11:116458124-116458146 TCCATCAGTGATGTGTAACGGGG - Intergenic
1093091930 12:14931656-14931678 GTCATCAGTGAAGCTTTATGAGG + Intronic
1097014330 12:55974429-55974451 CTCTTCAGCGCTGCTTAATGAGG - Intronic
1101481932 12:105106975-105106997 CTCTTCAGTGATTCGTAGTATGG + Intergenic
1105786072 13:23750556-23750578 AGCATCAGTGATGCGTCATGTGG - Intronic
1106453033 13:29901437-29901459 CTCATCAGTTCTGTGTGATGTGG - Intergenic
1108013054 13:46041173-46041195 CTCATCAGTGATGGATATTTGGG - Intronic
1124174149 15:27406442-27406464 CTCACCAGTGATGAGCCATGTGG + Intronic
1125143694 15:36440643-36440665 CCCATGAGTGATGCCTGATGGGG - Intergenic
1130041347 15:80407290-80407312 CTCTTCTGTGATGTGTAGTGGGG + Intronic
1137065362 16:35835628-35835650 CTCAGCAATGATGAGCAATGAGG - Intergenic
1137794286 16:51202172-51202194 ATCATCAGTGATGGGCAAGGAGG - Intergenic
1142984569 17:3688152-3688174 CACATCAGTGCTGCCTAAAGAGG - Intronic
1144416540 17:15052996-15053018 CTCCTCAGGAATGCTTAATGAGG - Intergenic
1144824608 17:18098773-18098795 ATCATCAGTGATGAGTGTTGTGG + Intronic
1144909814 17:18672021-18672043 CTCATCACTGCTGCGTGACGTGG + Intronic
1146018443 17:29252286-29252308 ATCATCAGTTATGCTGAATGTGG + Intronic
1165585794 19:36915117-36915139 CTCATGTGTGGTGGGTAATGGGG - Exonic
1168360395 19:55734964-55734986 CTAATGAGTGATGAGAAATGGGG + Intronic
927445214 2:23154550-23154572 CTGATCAGTGAGGTGTACTGTGG + Intergenic
927602597 2:24457135-24457157 ATCATCAGTGATGCATCTTGGGG + Intergenic
929231933 2:39568956-39568978 CTCATCTGAGATGGGGAATGAGG - Intergenic
930028661 2:47045120-47045142 CTCACCAGTGGTGAGTAGTGAGG - Intronic
930877459 2:56235109-56235131 TTCTTCAGTGATGTGCAATGTGG + Intronic
933420552 2:82040423-82040445 CTCATCAGTCATTAGTAATTAGG - Intergenic
936768575 2:115884458-115884480 CTGATCAGAGATGTATAATGAGG + Intergenic
946542399 2:220699006-220699028 CTCATCAGTGCTGTGTCAGGAGG - Intergenic
947170013 2:227301379-227301401 CTCATCAGTGATGCGTAATGAGG + Intronic
1169945347 20:10982457-10982479 CTCTTTAGAGATGTGTAATGTGG - Intergenic
1181022987 22:20113220-20113242 CTCTTCAGAGTTGAGTAATGTGG - Exonic
952845020 3:37681052-37681074 CTCTTCACGGATGGGTAATGAGG + Intronic
965610320 3:170536770-170536792 CTCATGAGAGATGCATAAGGTGG + Intronic
969881149 4:10175128-10175150 CTCGTCTGAGATGGGTAATGTGG + Intergenic
972537443 4:40011286-40011308 CTCCTCAGTGATGCCAACTGAGG - Intergenic
976277967 4:83297589-83297611 CTGCTCACTGATGCTTAATGAGG - Intronic
978002352 4:103572079-103572101 CTCTTCAGGGATGAGTCATGTGG + Intergenic
979782769 4:124675262-124675284 TTCACCAGTACTGCGTAATGCGG - Intronic
982315021 4:154023551-154023573 CTCAGCAATGATGCGGAATGGGG + Intergenic
991503159 5:67297715-67297737 AACATCACTGATGGGTAATGGGG - Intergenic
995496563 5:112750428-112750450 CTCATCACTAATGCCTCATGTGG - Intronic
996871713 5:128199841-128199863 CTCATCAGTGATGAATAAGTGGG - Intergenic
998066067 5:139159968-139159990 CACTTCTGTGATGCCTAATGAGG - Intronic
1003343942 6:5247757-5247779 TGCATCAGTGATGTCTAATGAGG + Intronic
1012318629 6:97814099-97814121 CTCAACAGTGAGCCGAAATGGGG + Intergenic
1012348474 6:98221589-98221611 ATCAGCAGAGATGCATAATGGGG + Intergenic
1013248683 6:108313074-108313096 CTGGCCAGTGATGCCTAATGGGG - Intronic
1013283851 6:108663717-108663739 CTCATCACTGCTGCGTGACGTGG - Exonic
1013609745 6:111783330-111783352 CTCATCAGTCATGGTTATTGGGG - Intronic
1037159952 8:15757522-15757544 CTCATCAATGATGTGTACTGTGG - Intronic
1037491637 8:19402017-19402039 TTCATCAGTGATGTGGAAAGGGG + Intergenic
1046777482 8:118179475-118179497 GTCTTCAGGGATGCTTAATGTGG + Intergenic
1050141898 9:2524835-2524857 CTGTTCAGTGATGAGAAATGAGG - Intergenic
1050208640 9:3227678-3227700 ATCATCAGTGTTGCTTTATGTGG + Intronic
1052076348 9:24145278-24145300 CTCAGCAGTGATTTGTAATCGGG + Intergenic
1189473835 X:41334243-41334265 CTCTTCAGGGATGAGTCATGTGG + Exonic
1192763566 X:74121002-74121024 CTCTTCAGGGATGAGTCATGTGG + Intergenic
1195004886 X:100676162-100676184 CTCCTCAGGGATCAGTAATGGGG - Exonic
1201338417 Y:12904927-12904949 CTCTTCAGGGATGAGTCATGTGG + Exonic