ID: 947174685

View in Genome Browser
Species Human (GRCh38)
Location 2:227352985-227353007
Sequence GAAGCCTTACAAACAAAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 209}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947174685_947174688 21 Left 947174685 2:227352985-227353007 CCTGTCTTTGTTTGTAAGGCTTC 0: 1
1: 0
2: 1
3: 9
4: 209
Right 947174688 2:227353029-227353051 GCATTAACAACTCCACAGTTTGG 0: 1
1: 0
2: 0
3: 12
4: 109
947174685_947174687 -10 Left 947174685 2:227352985-227353007 CCTGTCTTTGTTTGTAAGGCTTC 0: 1
1: 0
2: 1
3: 9
4: 209
Right 947174687 2:227352998-227353020 GTAAGGCTTCATCTTAAATTGGG 0: 1
1: 0
2: 0
3: 7
4: 139
947174685_947174690 26 Left 947174685 2:227352985-227353007 CCTGTCTTTGTTTGTAAGGCTTC 0: 1
1: 0
2: 1
3: 9
4: 209
Right 947174690 2:227353034-227353056 AACAACTCCACAGTTTGGGAAGG 0: 1
1: 0
2: 1
3: 10
4: 145
947174685_947174689 22 Left 947174685 2:227352985-227353007 CCTGTCTTTGTTTGTAAGGCTTC 0: 1
1: 0
2: 1
3: 9
4: 209
Right 947174689 2:227353030-227353052 CATTAACAACTCCACAGTTTGGG 0: 1
1: 0
2: 0
3: 11
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947174685 Original CRISPR GAAGCCTTACAAACAAAGAC AGG (reversed) Intronic
901095308 1:6674255-6674277 GAAGCCTTAAAAAAAAAGTGGGG + Intronic
902198926 1:14819484-14819506 GCAGCCTTACGAATAAAAACTGG + Intronic
904450969 1:30611271-30611293 GGAGCTTTACAGGCAAAGACAGG + Intergenic
905537546 1:38734978-38735000 GAAGCTCTACAAACAAGGTCAGG + Intergenic
907023912 1:51095872-51095894 GAAGCCTTACTAAAAAGAACAGG + Intergenic
909679540 1:78276504-78276526 GTAGCCTTGCCCACAAAGACAGG + Intergenic
909848695 1:80433334-80433356 GAAGCCTTCCAAAGAAGGACAGG - Intergenic
910690047 1:89956425-89956447 AAAGACTGAGAAACAAAGACTGG + Intergenic
912097090 1:106159246-106159268 AAAGCCTTACTAACATATACAGG - Intergenic
912600453 1:110927120-110927142 TTCGCCTTTCAAACAAAGACTGG - Intergenic
912871720 1:113312460-113312482 AAAGCCTTTCCAAGAAAGACGGG + Intergenic
916635343 1:166662156-166662178 GAATCCTAATAAACAAAGAAAGG + Intergenic
917833283 1:178916359-178916381 GAAGCCTGAGAAAAAAAGAGAGG + Exonic
918897801 1:190370069-190370091 GAAGAAGTACAAACAAAGAAAGG + Intronic
1068021157 10:51586188-51586210 GAAGCCTTGAAATCCAAGACAGG + Intronic
1068641697 10:59414934-59414956 AAAGCCTTCCCAAGAAAGACAGG + Intergenic
1069343629 10:67440809-67440831 GAAGCCTTTCCAAGAAAGATGGG + Intronic
1071418626 10:85464934-85464956 GAAGCCTTCCCAAGAAGGACAGG + Intergenic
1071673276 10:87631582-87631604 TAACCCTTACAAACATAGGCTGG + Intergenic
1075386258 10:122057500-122057522 GAAGCCTTAAAAACTAAGTTTGG + Intronic
1077709857 11:4524976-4524998 GAAACCATACAGACAAAGAGTGG + Intergenic
1079805297 11:24923388-24923410 GAAGCCATAGCTACAAAGACAGG + Intronic
1080298581 11:30758353-30758375 GAAACCTTAGAAACCAACACTGG - Intergenic
1085372162 11:76019474-76019496 AAAGCCTTCCCAAGAAAGACAGG - Intronic
1085980651 11:81719556-81719578 AAAGCCTTCCAAAGAAGGACAGG + Intergenic
1087700162 11:101428184-101428206 GAAACCTTACAAGCCAAGAGAGG - Intergenic
1091784879 12:3237312-3237334 GATGACTTACGATCAAAGACAGG + Intronic
1092060303 12:5545476-5545498 GAAGCCTCACAAGCCAAGCCTGG + Intronic
1093191603 12:16081220-16081242 GAAGCCTGACAAACACAGCAAGG - Intergenic
1094054821 12:26257924-26257946 GAAGCCCAACAAACAAACAGTGG + Intronic
1094080873 12:26533880-26533902 GCAGCCCTACAAACTAATACAGG + Intronic
1094566254 12:31600816-31600838 GTAGCCTTACAAGGAAAGCCAGG + Intergenic
1096378965 12:51139219-51139241 GAAGCTTTATAAACAGAGAAGGG - Intronic
1096860427 12:54523375-54523397 GAAGCTTCAGAAACAAACACAGG - Exonic
1098305380 12:69097402-69097424 AAAGCCTTAAAAGCAAAGACAGG - Intergenic
1098488926 12:71052559-71052581 GAATCCTTAAAAACACAGAAAGG + Intronic
1098714656 12:73814640-73814662 GAAACTTTACAAACTAAGCCAGG - Intergenic
1099372345 12:81851105-81851127 TAAGCCTCAAAAACAAACACAGG - Intergenic
1100715856 12:97304412-97304434 GAAAACAAACAAACAAAGACTGG - Intergenic
1102073633 12:110042755-110042777 GGAGACTCACAAACTAAGACAGG + Intronic
1104187075 12:126443119-126443141 GAAGAGTTTAAAACAAAGACAGG - Intergenic
1105687323 13:22797190-22797212 AAGGCATTACAAACACAGACAGG - Intergenic
1107931437 13:45310963-45310985 GAACACTTACAATAAAAGACAGG - Intergenic
1109786992 13:67190054-67190076 TAAGCCTTACAAAATGAGACTGG - Intronic
1110376862 13:74803552-74803574 GAAGCCTTCTCAAGAAAGACAGG + Intergenic
1114134294 14:19829480-19829502 GATGCCTTACAGACTAACACAGG + Intergenic
1115015740 14:28611294-28611316 GAAGCCTTGCAAACAACGTTAGG + Intergenic
1117418495 14:55519901-55519923 AAAGCCTTTCCAAGAAAGACAGG + Intergenic
1117565415 14:56989701-56989723 GAAACCTTACAAATAAATATTGG - Intergenic
1117606345 14:57432225-57432247 AAAGCCTTCCCAAGAAAGACAGG + Intergenic
1120272798 14:82336052-82336074 TAAGCCTTATAAACAAACCCAGG - Intergenic
1120509846 14:85399887-85399909 GAAGCATTTTAAACAATGACTGG - Intergenic
1121917289 14:97847175-97847197 GATGCCTCACAAACTAAGAATGG + Intergenic
1124638316 15:31379065-31379087 GAAGTGTTACTAACAAATACAGG + Intronic
1125859235 15:42982347-42982369 GAGGTCCTAAAAACAAAGACAGG + Intronic
1126881080 15:53098758-53098780 GGAACCTGACCAACAAAGACAGG + Intergenic
1126938005 15:53733157-53733179 GAATCCTGACATACAAAGAAGGG + Exonic
1126992052 15:54389407-54389429 GAAAGCTCACAAACACAGACAGG - Intronic
1127837675 15:62803919-62803941 AAAGCCTTCCCAAGAAAGACAGG - Intronic
1128347128 15:66861357-66861379 GTAGCCTTGCAGACAAAGGCTGG + Intergenic
1129221148 15:74132401-74132423 GAAGGCTTAGAAACACAGAGAGG + Intronic
1130961851 15:88664685-88664707 GAAGCCTTCCCAAGAAAGATGGG + Intergenic
1132177983 15:99730817-99730839 GAAGCCTGTCCTACAAAGACCGG - Intronic
1133498811 16:6345719-6345741 GAACCCATACAATCTAAGACTGG + Intronic
1134211878 16:12284431-12284453 GAAGCCCTCCAAAGAAAGTCAGG - Intronic
1135316553 16:21451186-21451208 GAAGCCATTCAAAAAAATACAGG - Intergenic
1135369475 16:21883431-21883453 GAAGCCATTCAAAAAAATACAGG - Intergenic
1135442338 16:22487696-22487718 GAAGCCATTCAAAAAAATACAGG + Intronic
1135717856 16:24788560-24788582 GAAGCCTGACATGGAAAGACAGG - Intronic
1136313220 16:29429890-29429912 GAAGCCATTCAAAAAAATACAGG - Intergenic
1136441356 16:30271649-30271671 GAAGCCATTCAAAAAAATACAGG - Intergenic
1139302755 16:65959358-65959380 GAAGTCTAACAGATAAAGACTGG + Intergenic
1139887852 16:70223962-70223984 GAAGCCATTCAAAAAAATACAGG - Intergenic
1141386154 16:83624197-83624219 GATGCCTTATACACAAAGGCAGG + Intronic
1144729379 17:17517856-17517878 GAAGCCTTACGACCAAGGCCTGG - Intronic
1148221666 17:45866857-45866879 GAAGCCTTAAAAAAAAAGTGAGG - Intergenic
1149033786 17:52112355-52112377 GAAACTTTACTAACAGAGACAGG - Intronic
1149042447 17:52206034-52206056 GAAGCCATGGAAACAAAAACAGG - Intergenic
1155548881 18:26943704-26943726 GCAGCCACACAAACAAAGAGAGG - Intronic
1156569300 18:38234790-38234812 GAAGTCTTAGAGACAAAGAATGG + Intergenic
1160614344 18:80112773-80112795 GAAGCCTGGGATACAAAGACTGG - Intronic
1163225037 19:15954566-15954588 GAAGCCTTCCTAAGAAAGATGGG - Intergenic
1163345375 19:16738067-16738089 AAAGCTTTACTTACAAAGACAGG - Intronic
1166408184 19:42538785-42538807 AAAGCCTTCCCAAGAAAGACAGG - Intronic
925698805 2:6612676-6612698 GAAGCCTTTCCAAGAAAGATGGG - Intergenic
926452518 2:13023230-13023252 GAAGGGTTTGAAACAAAGACAGG + Intergenic
928816346 2:35299157-35299179 GAAGCACTACAAACACACACAGG - Intergenic
929511029 2:42566241-42566263 GAAACCTTTCAACCAAAGACGGG - Intronic
930160279 2:48147610-48147632 GAAGCATTACAAATGAAGAAAGG + Intergenic
931185950 2:59951542-59951564 GAAGCCTTTCACACACAGAAAGG + Intergenic
936680405 2:114763657-114763679 GAATCCTTAAAACCAAAGAAGGG + Intronic
938377052 2:130814889-130814911 CTAGGCTTACAAACAAAAACCGG - Intergenic
941038319 2:160591027-160591049 GAAGATTTACAAACAAAAAAAGG - Intergenic
941353795 2:164464870-164464892 ATAGCATCACAAACAAAGACAGG - Intergenic
942750214 2:179277971-179277993 AAAGCTTTCCAAAGAAAGACAGG + Intergenic
947034820 2:225840195-225840217 GAAACCTTCTTAACAAAGACTGG + Intergenic
947174685 2:227352985-227353007 GAAGCCTTACAAACAAAGACAGG - Intronic
947846715 2:233250754-233250776 GCAGCTTAACAATCAAAGACAGG + Intronic
1169188831 20:3644207-3644229 GGAGCCTCACAAACACAGAGAGG - Exonic
1169291539 20:4357437-4357459 AAAGCTTTACAAACACAGCCTGG - Intergenic
1170971050 20:21116878-21116900 GTAGCCCTACAAACTAATACAGG + Intergenic
1172154499 20:32814256-32814278 GGAGCCTTAAAAATAAAAACAGG - Intergenic
1176510805 21:7746021-7746043 GAAACCTGACAAAGGAAGACAGG + Intronic
1177212965 21:18092339-18092361 AAAGCCTTCCCAAGAAAGACAGG + Intronic
1178644918 21:34376550-34376572 GAAACCTGACAAAGGAAGACAGG + Intronic
1179261370 21:39760926-39760948 GAAATCTTTCAAACAAAGTCTGG + Intronic
1180206149 21:46262161-46262183 GGAGACTTCCAAACAAAGAAAGG + Intronic
1180824529 22:18853504-18853526 GAGGGCTTACAAACAATGCCTGG + Intronic
1184620825 22:45674970-45674992 GAAGCCTCACAAACTAAACCAGG - Intronic
1203215956 22_KI270731v1_random:5981-6003 GAGGGCTTACAAACAATGCCTGG - Intergenic
949451999 3:4196364-4196386 GAAGCCTGCCACACAAAGCCTGG - Intronic
949460620 3:4289181-4289203 GAAGCCTGAGAAACTCAGACTGG + Intronic
951075510 3:18386539-18386561 GAAGGTTTACCAGCAAAGACTGG + Exonic
951758727 3:26120831-26120853 GAAATCTAACAAAGAAAGACTGG + Intergenic
952236845 3:31488718-31488740 GTAGCCTGACAGACTAAGACAGG + Intergenic
953362288 3:42308759-42308781 AAAGCCTTCCCAAGAAAGACAGG - Intergenic
955009442 3:54999906-54999928 AAAGCAATACAAACAAAGCCTGG - Intronic
958966064 3:100559894-100559916 GAAGCAAAACAAACAAAAACAGG + Intronic
961219578 3:125189167-125189189 AAGGCCTTACAAGCAAAGGCTGG + Intronic
963168547 3:142228537-142228559 TAAGCTTTAAGAACAAAGACAGG - Intergenic
963538545 3:146558912-146558934 AAATCCTGACAAACAAAGCCTGG + Intergenic
964835481 3:160933757-160933779 GAAACATTTCAAATAAAGACAGG - Intronic
965741290 3:171877302-171877324 GAAGTGTTCAAAACAAAGACCGG - Intronic
966515316 3:180813987-180814009 AAAGCCAGACCAACAAAGACGGG - Intronic
967351748 3:188521341-188521363 GATGTCTTACAAGCACAGACTGG + Intronic
967696827 3:192542631-192542653 AAAGCCTTCCAAAGAAGGACAGG - Intronic
967926973 3:194658042-194658064 GATGCCTGATAAACAGAGACGGG + Intronic
969064727 4:4469786-4469808 GTATCCTTAAAAACAAAGAGAGG + Intronic
970877842 4:20893371-20893393 GAAGCCTTACAAACAAAAAGTGG - Intronic
972099756 4:35399820-35399842 CAAAACTTACAAAGAAAGACAGG - Intergenic
972268490 4:37485597-37485619 GTAGCAGCACAAACAAAGACAGG + Intronic
973284194 4:48397029-48397051 GAAGTCTTAAAAATATAGACTGG - Intronic
973879717 4:55257188-55257210 GAACCTTGACCAACAAAGACAGG - Intergenic
975335611 4:73171426-73171448 AAAGCCTTCCAAAGAAGGACAGG + Intronic
977328784 4:95610297-95610319 GAAACCAAACAAACAAAAACAGG - Intergenic
982419159 4:155173775-155173797 GAAGCCTATCAAACATAAACAGG + Intergenic
982466491 4:155739523-155739545 AAACCCTAACAAACAAATACAGG + Intergenic
983421187 4:167519126-167519148 GAAGCCTTTCAAATTTAGACAGG + Intergenic
983483826 4:168309939-168309961 GCAGCTTTACAGATAAAGACAGG - Intronic
985012263 4:185595629-185595651 GAAGACTGAGAAAAAAAGACTGG - Intronic
988082877 5:26434768-26434790 AAAGCCTTCCCAAGAAAGACAGG + Intergenic
990753386 5:59041271-59041293 GAAGCATTACACACAAATATAGG + Intronic
991542809 5:67748461-67748483 GAGGCCTGACAAACACAGCCTGG - Intergenic
991596168 5:68308211-68308233 GAAGCTTTACAGACAATCACAGG + Intergenic
992291523 5:75284273-75284295 AAAGCCTTCCCAAGAAAGACAGG + Intergenic
993206942 5:84894458-84894480 GAAGCCTTTCCAAGAAAGACAGG - Intergenic
993380669 5:87203559-87203581 GAAGCCTTTCAGACAAACAGTGG - Intergenic
993981410 5:94546708-94546730 AAAGCATTCCCAACAAAGACAGG + Intronic
996429993 5:123363577-123363599 TAAGCATTACAAATGAAGACAGG - Intronic
996450914 5:123623603-123623625 GAAGACTTACAAACAAATCAGGG - Intergenic
996902609 5:128559964-128559986 TAAGACTTCCAAACAAAGAAAGG - Intronic
997104845 5:131006575-131006597 AAAGCCTTCCAAAGAATGACAGG + Intergenic
997180473 5:131823819-131823841 GAAGCCTTCCCAAGAAGGACAGG - Intronic
998542067 5:142992212-142992234 GAATCCATTCAAACAAAGATAGG - Intronic
999625005 5:153511465-153511487 GAAGCCCAAAAAACAAAAACTGG - Intronic
1001338473 5:170821760-170821782 AGAGCCTTAAAAACAAAGAGTGG + Intergenic
1003925936 6:10877526-10877548 GAAGTCTTACATAGAAAGAGTGG - Intronic
1004852664 6:19716124-19716146 GAACCCTGAAAAACAAGGACAGG + Intergenic
1005176680 6:23054586-23054608 GAAGCAAGACAAAAAAAGACAGG - Intergenic
1006334596 6:33413960-33413982 GAAGACTCACAAGCAAGGACGGG - Intronic
1008153567 6:47987219-47987241 GAAGGCTTAAAAACACACACTGG + Intronic
1008822426 6:55650313-55650335 AAAGCCTTCCCAAGAAAGACAGG - Intergenic
1009478891 6:64130660-64130682 GATGCCTTCCGAACAAAGAGGGG + Intronic
1015079218 6:129203094-129203116 GAAGTTTTAAAAAGAAAGACTGG + Intronic
1016623679 6:146142015-146142037 AAAGCCTTCCTAAGAAAGACAGG - Intronic
1023921900 7:44636315-44636337 GAAACCTCACAACCAAGGACTGG + Intronic
1024468159 7:49736483-49736505 GAAGACTTCCAAGAAAAGACAGG + Intergenic
1024662287 7:51510157-51510179 AAAGCCTTCCAAACAAGAACAGG - Intergenic
1025754881 7:64329380-64329402 AAAGCCTTTCTAAGAAAGACAGG - Intronic
1027673523 7:81131194-81131216 GAAGTCTTACAAAGAAAGTATGG - Intergenic
1030278970 7:107750622-107750644 GAAGTCATAAAAGCAAAGACCGG - Intronic
1031288192 7:119899609-119899631 GAAGCCTTTCTAAGAAAGAAGGG - Intergenic
1031855851 7:126921836-126921858 GAAGCTTTCCAAACCAAGAAAGG + Intronic
1032251784 7:130263972-130263994 TTGGCCTTACAGACAAAGACGGG + Intergenic
1033222086 7:139534476-139534498 CCAGCCTTATAAAAAAAGACTGG + Intronic
1033723085 7:144083109-144083131 GAAGCCTTCCAAATAGAGAATGG + Intergenic
1035139224 7:156739757-156739779 AAAGCCTTCCCAAGAAAGACAGG + Intronic
1035603140 8:910582-910604 GAATGCTTAGAAATAAAGACAGG - Intergenic
1035832659 8:2714485-2714507 GAAACCTCAGAAACAAAGTCAGG - Intergenic
1035967367 8:4208286-4208308 GAAGAATTAGAAAAAAAGACTGG + Intronic
1036477832 8:9109733-9109755 GAAGCTTTGCAAACAATGATCGG - Intronic
1036480106 8:9131905-9131927 GAAGCCAGACAGACAATGACAGG - Intergenic
1037116019 8:15228826-15228848 GAAGTCATGCAAACAAAAACTGG + Intronic
1038581007 8:28749456-28749478 GACGCCTCACAAAGAAAGATGGG - Intronic
1039680837 8:39734254-39734276 GAAGCCTTAGAAAAAAATATAGG + Intergenic
1041152476 8:54950158-54950180 GATGCATTACAAACAACAACTGG - Intergenic
1042460234 8:69057231-69057253 GTAGCCTTTTAAACAAATACTGG + Intergenic
1045172381 8:99685979-99686001 AAAGCCTTCCTAAGAAAGACAGG - Intronic
1047985959 8:130234041-130234063 GAACTCTTAAAAACAAAAACAGG - Intronic
1051012005 9:12428232-12428254 GAAGCCTTAGTAACCAAAACAGG + Intergenic
1054820087 9:69513631-69513653 GAAGCCTAGAAAACAAAGACAGG + Intronic
1055073721 9:72193260-72193282 AAAGCCTTCCCAAGAAAGACAGG - Intronic
1057536402 9:95912266-95912288 GAAGCCTCAAGAACAAAGACAGG - Intronic
1057563055 9:96143580-96143602 GAAGCCTTTTAAAGCAAGACAGG - Intergenic
1058116074 9:101085533-101085555 GAAGTCTTAGAAACAAACATTGG + Intronic
1059041921 9:110823642-110823664 AAAGCCTTGCCAAAAAAGACAGG + Intergenic
1203446889 Un_GL000219v1:64971-64993 GAAGCCATGCAAACTAATACAGG - Intergenic
1185749030 X:2595690-2595712 TGAGCCTTACAAACATACACTGG + Intergenic
1185816977 X:3165109-3165131 AAAGCCTTAAGAATAAAGACTGG - Intergenic
1186979723 X:14945890-14945912 GAAGGCTGAGAAACAAAGGCAGG - Intergenic
1187634026 X:21206444-21206466 GGAATCTTACAAACAAAGCCAGG + Intergenic
1187752038 X:22477520-22477542 GAAACCCTACAAACTAAGAAGGG - Intergenic
1189254396 X:39626535-39626557 GTAGCCTTAAAAAAAAAAACTGG - Intergenic
1189342345 X:40213694-40213716 GAACCCGTACTAACACAGACAGG + Intergenic
1189425031 X:40891971-40891993 AAAGCCTTAAAAACAATGACTGG - Intergenic
1191645480 X:63476160-63476182 GAAAACTTACAAAGAAATACTGG + Intergenic
1192241881 X:69338023-69338045 AAAGCGTCACAAACAAAAACGGG + Intergenic
1192406180 X:70888081-70888103 AAAGCCTTCCAAAGAAGGACAGG + Intronic
1194489532 X:94529572-94529594 AAAGCCTTTCTAAGAAAGACAGG + Intergenic
1194586216 X:95737091-95737113 AAAGCCTTCCCAAAAAAGACAGG + Intergenic
1195312423 X:103644230-103644252 AAAGCCTTCCCAAGAAAGACAGG + Intergenic
1196304782 X:114088026-114088048 AAAGCCTTCCCAAGAAAGACAGG + Intergenic
1196898471 X:120360724-120360746 GAAGCCTTAAAACCAAACAATGG - Intergenic
1196918769 X:120565010-120565032 GAAGAAATACAAACAAAGACAGG + Intronic
1197925787 X:131645944-131645966 GAAGCCTTAGTAACATAGATAGG + Intergenic
1198222303 X:134613740-134613762 GAAGCCATAGAAACAGAGAAAGG - Intronic
1198537716 X:137602302-137602324 GAAGCCTTCCAAAGAAGGACAGG + Intergenic
1199485231 X:148339281-148339303 GAAGCCTTTCCAAGAAGGACAGG + Intergenic
1200023403 X:153231546-153231568 GAGCCATTACAAAAAAAGACTGG + Intergenic
1202042780 Y:20702399-20702421 GAAGCCTTCCCAAGAAAGAGAGG + Intergenic