ID: 947179004

View in Genome Browser
Species Human (GRCh38)
Location 2:227395578-227395600
Sequence CTGTGTGCCCAGAGGGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947179004_947179009 -10 Left 947179004 2:227395578-227395600 CCAGCCTCCCTCTGGGCACACAG No data
Right 947179009 2:227395591-227395613 GGGCACACAGCTGACAGGTGAGG No data
947179004_947179010 -9 Left 947179004 2:227395578-227395600 CCAGCCTCCCTCTGGGCACACAG No data
Right 947179010 2:227395592-227395614 GGCACACAGCTGACAGGTGAGGG No data
947179004_947179011 -8 Left 947179004 2:227395578-227395600 CCAGCCTCCCTCTGGGCACACAG No data
Right 947179011 2:227395593-227395615 GCACACAGCTGACAGGTGAGGGG No data
947179004_947179012 -2 Left 947179004 2:227395578-227395600 CCAGCCTCCCTCTGGGCACACAG No data
Right 947179012 2:227395599-227395621 AGCTGACAGGTGAGGGGCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947179004 Original CRISPR CTGTGTGCCCAGAGGGAGGC TGG (reversed) Intergenic
No off target data available for this crispr