ID: 947190888

View in Genome Browser
Species Human (GRCh38)
Location 2:227503466-227503488
Sequence AACAGGCAACAGGCCAAATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 865
Summary {0: 1, 1: 5, 2: 58, 3: 175, 4: 626}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947190888_947190893 19 Left 947190888 2:227503466-227503488 CCAAATTTGGCCTGTTGCCTGTT 0: 1
1: 5
2: 58
3: 175
4: 626
Right 947190893 2:227503508-227503530 TGAGCTACCATTGTGAGACATGG 0: 1
1: 0
2: 0
3: 5
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947190888 Original CRISPR AACAGGCAACAGGCCAAATT TGG (reversed) Intronic
900006195 1:54605-54627 AACAGGCCAAAGATCAAATTAGG - Intergenic
900568677 1:3347765-3347787 AGCAGGCATCAGGCCAGATCTGG - Intronic
901176963 1:7310485-7310507 AACAGGCAGTGAGCCAAATTTGG + Intronic
901180739 1:7340201-7340223 TACAGGCAGCAGGCTGAATTTGG + Intronic
901561487 1:10075237-10075259 AACAGGCAGTAGCCCAGATTTGG + Intronic
901935498 1:12623515-12623537 AACAGTCCACAGACCAAATCTGG - Intergenic
902033302 1:13438615-13438637 AACAGGCTATAGGCTAGATTTGG - Intergenic
902190687 1:14760995-14761017 GACAGGCAGCGGGCCAGATTTGG + Intronic
902276193 1:15341237-15341259 TACAGCCCACAGGCCAAATCGGG - Intronic
902559134 1:17266147-17266169 AACAGGCAGTAGGCCAGATTTGG + Intronic
903127021 1:21255148-21255170 AACGGACAACAGGTCAAATTCGG + Intronic
903269726 1:22179902-22179924 AACAGGCACCAGGAAGAATTTGG - Intergenic
903526813 1:23996913-23996935 AACAGGCTGCAAGCCAGATTTGG - Intergenic
903727642 1:25462875-25462897 AACAGCACACAGGCCAAATCTGG + Intronic
903727643 1:25462888-25462910 AACAGGCAGTGGGCCAGATTTGG - Intronic
905044648 1:34986027-34986049 ATCAGACATCTGGCCAAATTTGG - Intronic
905089232 1:35414637-35414659 AACAGGGAGCAGGCCAGATTTGG - Intronic
905473372 1:38209075-38209097 TACAGCCCACAGGCCAAATCAGG - Intergenic
905497211 1:38401695-38401717 AAGAGGCAGCAGGTCAGATTTGG - Intergenic
906816449 1:48885118-48885140 AACAGGAAACAGACCAGATTTGG - Intronic
906902229 1:49847466-49847488 AACAGACAACATGCAGAATTGGG + Intronic
907398899 1:54212312-54212334 AATAGGTAGCAGGCCAGATTTGG + Intronic
907967899 1:59350976-59350998 AACAGGCAGTAGGCCAGATTTGG - Intronic
908004702 1:59715847-59715869 AACAGTCAGTAGGCAAAATTTGG - Intronic
908334555 1:63107940-63107962 AAGGGACAACATGCCAAATTGGG + Intergenic
908405724 1:63812254-63812276 AACAGGCCTCAGGCCAAATTTGG - Intronic
908741640 1:67334841-67334863 AACAGGCAGAGGGCCAGATTTGG + Intronic
909986526 1:82167428-82167450 AACAGGTAGTGGGCCAAATTTGG - Intergenic
910423686 1:87098760-87098782 AACAGGTGAAAGGCCAAACTGGG - Intronic
911113198 1:94213614-94213636 AACAGGCAGCTGGCCAGATTTGG + Intronic
911226794 1:95315813-95315835 AACAGGCAGCAGGCTGGATTTGG + Intergenic
912697178 1:111850234-111850256 AGCAGGGAACAGGCCAACTGAGG - Intronic
913008922 1:114663621-114663643 AACAGGCAGTGGGCCAAATTTGG - Intronic
913457973 1:119053129-119053151 AAGAGTCCACAGGCCAGATTTGG - Intronic
913485690 1:119331083-119331105 AATAGGCAGCACGCCAGATTTGG + Intergenic
914340662 1:146757143-146757165 AACAAGCAGCAGGACAGATTTGG + Intergenic
914426508 1:147582553-147582575 AACAAGCCACAGGACAGATTCGG - Intronic
914736368 1:150421071-150421093 AATAGGCAGCAGGCCAGATTTGG + Intronic
914756518 1:150564808-150564830 AACAGGCAGCAGGGCAAATTTGG + Intergenic
915961913 1:160274081-160274103 TACAGCCCACAGGCCAAATCTGG - Intergenic
916045948 1:161000054-161000076 AACAGGCAACAGGGTGAACTTGG - Intronic
916083002 1:161247901-161247923 CACAGGCAGCAGGCCAGATTGGG - Intergenic
916481420 1:165218097-165218119 AACAGGCATCAGGCCAGATTTGG + Intronic
916925663 1:169517977-169517999 AACAGGCAGCGGGCCAAATTTGG - Intronic
917622467 1:176810620-176810642 AACAGGCAGCAGACCAGACTGGG + Intronic
917648423 1:177051343-177051365 AACAGGCAGTGGGCCACATTTGG - Intronic
918198705 1:182246953-182246975 AACAGGCAGTGGGCCAGATTTGG + Intergenic
918747435 1:188222918-188222940 TATAGCCTACAGGCCAAATTTGG - Intergenic
919117882 1:193304010-193304032 AACAAGTAACAGCCCATATTTGG + Intergenic
919272777 1:195371334-195371356 AACAGACAACAAGCCAGATTTGG - Intergenic
919299350 1:195740689-195740711 AATAGGCAACAAGGCAATTTTGG + Intergenic
920353501 1:205353167-205353189 AACAGGCAGCAGGCCAGGGTTGG - Intronic
920395426 1:205642086-205642108 AAAAGGAAACAGGCCCAATGAGG - Intergenic
920784981 1:209032758-209032780 AACAGACAACAGGCCCCAGTTGG - Intergenic
920997008 1:211002982-211003004 AACAGGCCACTGGCAAAATTTGG - Intronic
921033889 1:211358022-211358044 AACAAGTAGCAGGCCAGATTTGG + Intronic
921258666 1:213365925-213365947 AACAGGTGGCAGGCCAGATTTGG + Intergenic
921436856 1:215133968-215133990 AACAAACAAGAGGCCAAGTTTGG + Intronic
921504022 1:215944154-215944176 AATAGGCAGCTGGCCAAATTTGG - Intronic
921871623 1:220146604-220146626 TACAGGCATCAGTTCAAATTTGG + Intronic
922251341 1:223851388-223851410 AACAGGCAGAAGGCCAAATTTGG - Intergenic
922463585 1:225830847-225830869 AACAGGTAGCAGGCTACATTTGG - Intronic
922635181 1:227161645-227161667 AACAGGCAGCAAACCAGATTTGG - Intronic
922740097 1:228009718-228009740 ACCAGGAAACAGCCCAAATCAGG + Intronic
923562528 1:235052110-235052132 AACAGGCCACTGGCCAGATTTGG + Intergenic
923694947 1:236239262-236239284 AATAAGCAGCAGGCCAGATTTGG - Intronic
924590127 1:245395810-245395832 AATAGGCAAAGGGCAAAATTTGG + Intronic
924662872 1:246038055-246038077 AACAGGCAGCAGGCCAGATATGG + Intronic
924681970 1:246245181-246245203 AACTGGCAACAGGCCAGACATGG + Intronic
1062889217 10:1045089-1045111 AACAGGCAGCAGGCCAGATTTGG + Intronic
1063890095 10:10620145-10620167 AACAGGTAGTGGGCCAAATTCGG - Intergenic
1064369742 10:14741033-14741055 AACAGTCAACAGGTGACATTAGG + Intronic
1064433295 10:15289736-15289758 AGCAGGCAGCAGGCCACATTTGG - Intronic
1064669837 10:17701444-17701466 AACAGGCAACAGGCTAAATTTGG - Intronic
1064797907 10:19034591-19034613 AACAGGACACAGGCCAAATTTGG + Intergenic
1067356606 10:45534264-45534286 AATAGGCAGCAGGCTAGATTTGG + Intronic
1067739710 10:48885889-48885911 AAGAGGCAAAAGGCTATATTTGG - Intronic
1068581675 10:58747834-58747856 CACAGGCAGCTGGCCAGATTTGG - Intronic
1068646227 10:59470900-59470922 AAAAGGCAGCAGCCCCAATTAGG + Intergenic
1068755712 10:60650205-60650227 AACAGGTAACAGGCTGGATTTGG - Intronic
1069061226 10:63896509-63896531 AATAGGCAGTAGGCCACATTTGG - Intergenic
1069296601 10:66853020-66853042 AACAGGTGGCAGGCCAGATTTGG - Intronic
1069359124 10:67621840-67621862 AATAGACAAGAGGCCAGATTTGG - Intronic
1069669750 10:70191873-70191895 AACAGGCAGCAGGCTGGATTTGG + Intergenic
1070413231 10:76164445-76164467 AACAAGCCACTGGCCATATTTGG - Intronic
1070431971 10:76349351-76349373 AACAGGCAGTGGGCCAGATTTGG + Intronic
1071021655 10:81064348-81064370 AACAGGCCACCAGCCATATTTGG - Intergenic
1071552801 10:86580183-86580205 AAAAGGCAGCAGGCCAGATTTGG - Intergenic
1072512028 10:96137036-96137058 AACAGGCAGCAGGCCAGATTTGG + Intronic
1072557534 10:96532738-96532760 AACAGGGAGCAGGCCAGATTTGG + Intronic
1072865733 10:99059147-99059169 AACAGGAAGCAGGCCAGATTTGG + Intronic
1072952138 10:99857181-99857203 AACAGGTAGCAGGGCAAATTTGG - Intergenic
1073408165 10:103316875-103316897 AACAGGTGACAGGCTAGATTTGG - Intronic
1073993766 10:109293080-109293102 AACAGGCAGTGGACCAAATTTGG - Intergenic
1074343226 10:112654991-112655013 AACAGGCCACAGGCTGGATTTGG + Intronic
1074460899 10:113636012-113636034 AGCTGGCAACAGGCCCAATCTGG - Intronic
1074522042 10:114234839-114234861 AAGAGACCACAGACCAAATTAGG + Intergenic
1074922793 10:118034169-118034191 AACTGGCAGCAAGCCAGATTTGG + Intronic
1075009913 10:118858909-118858931 AACAGCCAATGGGCCAATTTTGG - Intergenic
1075038109 10:119086248-119086270 AACAGGCAGTAGACCAAATTTGG + Intergenic
1075283873 10:121166072-121166094 AAGAGGAAAGAGGTCAAATTTGG + Intergenic
1075358575 10:121807743-121807765 AACAAGCAGCAGACCAAATTTGG - Intronic
1076154860 10:128195938-128195960 AACAGGCAGCAGGCTAGATTTGG - Intergenic
1077952200 11:6972338-6972360 AACAGGTGACAGGCCAAATTTGG + Intronic
1078116576 11:8458435-8458457 AACAGGTAGCAGGCCCAATGTGG + Intronic
1078123269 11:8532283-8532305 AGCAAGCGACAGGCCAGATTTGG - Intronic
1078624984 11:12947162-12947184 AATAGGCAACAGGGAAGATTTGG - Intergenic
1078760170 11:14245369-14245391 GACAGACAACAGACCAAGTTGGG + Intronic
1078880579 11:15444986-15445008 AACAGGCAGCAGGGTGAATTTGG - Intergenic
1079049222 11:17138806-17138828 AACAGAGAGCAGGCCAGATTTGG + Intronic
1079138666 11:17792941-17792963 AAGAGGCTACAAGTCAAATTTGG + Intronic
1079963897 11:26957104-26957126 AACAGTCAAGAGGCAAAAATGGG - Intergenic
1080333635 11:31171388-31171410 AACAGGCTACAGGCTGGATTTGG + Intronic
1080479365 11:32630291-32630313 AACAGGCAGCAGGCTGCATTTGG - Intronic
1080868877 11:36219046-36219068 AACAGGTAGCAGGTCAGATTTGG - Intronic
1081547327 11:44080806-44080828 AACAGGCAGCAGGCTATGTTTGG + Intronic
1082096186 11:48131580-48131602 AACAGACAATGAGCCAAATTTGG - Intronic
1084065716 11:66702984-66703006 AACAGGCAGCAGGCTGGATTTGG + Intronic
1084103654 11:66966492-66966514 AACCTGGAACAGGTCAAATTGGG - Intergenic
1084682526 11:70674844-70674866 AACAGGCAATGGGCCAGATTTGG + Intronic
1085607437 11:77914747-77914769 AGCAGGCAACAGGCCAGCTTTGG + Intronic
1086486774 11:87312764-87312786 AACAAGTAGCAGGCCAGATTTGG + Intronic
1087283198 11:96235243-96235265 AACAGCCTGCAGGCCAGATTTGG - Intronic
1087949183 11:104199201-104199223 AACAGGCACTGGGCCAAATTTGG + Intergenic
1088526084 11:110756570-110756592 AACAGTGAACAGGACAAATATGG - Intergenic
1088726544 11:112642173-112642195 ATCAGGCTACAGGCCAGATTTGG + Intergenic
1088758332 11:112906005-112906027 AACAGGTGGCAGGCCAGATTTGG + Intergenic
1089276374 11:117338812-117338834 AACAGGCAAGAGGCCAAGGTAGG - Intronic
1089425898 11:118374478-118374500 AACAGGTGGCAGGCCAGATTTGG - Intronic
1090069671 11:123532637-123532659 CATAGCCAACAGGCCAAATTCGG + Intronic
1090373614 11:126273920-126273942 AACAGGCAGCAGGTCGGATTTGG + Intronic
1090713814 11:129412371-129412393 GACAGGCAAGACCCCAAATTGGG + Intronic
1091486312 12:892414-892436 AACAGGCAGTAGGCTGAATTTGG + Intronic
1091880635 12:3974654-3974676 AACAGGCAGCAGGCAGGATTAGG - Intergenic
1092846155 12:12587004-12587026 AACAGGCAATTGGCCAGCTTAGG + Intergenic
1092881963 12:12893695-12893717 AAGAGGCTATAGGCCATATTTGG - Intronic
1093165166 12:15796889-15796911 AACAGGTGACAGGCCAAGTGTGG + Intronic
1093316114 12:17652170-17652192 ATTAAGCATCAGGCCAAATTTGG - Intergenic
1093440741 12:19192896-19192918 AACAGGCAGCAGGCTGGATTTGG - Intronic
1094281912 12:28749600-28749622 AACACGCAGCAGGCCATAATAGG + Intergenic
1094357161 12:29590139-29590161 AACAGGCAGCAGGCCACATTTGG + Intronic
1095156630 12:38864247-38864269 AACCAGCAGCAGGCCAGATTTGG - Intronic
1095549900 12:43423303-43423325 AATAGGCAACAGGCCAGATTTGG + Intronic
1095632341 12:44392937-44392959 AACAAACATCAGGGCAAATTTGG + Intergenic
1095837866 12:46658030-46658052 AACAGAAAACAGGCAAAATAGGG + Intergenic
1096371865 12:51075670-51075692 AACAGGCATTGGGCCAGATTTGG + Intronic
1096520823 12:52183636-52183658 ACCAGGCGGCAGGCCAAATGAGG + Intronic
1097887681 12:64745927-64745949 AAAAGTCATCAGGCCAGATTTGG - Intronic
1098115026 12:67166024-67166046 AATAGGCCACAGGCCAGATTTGG - Intergenic
1098177681 12:67809892-67809914 AACAGACAACTGACCAAAATGGG - Intergenic
1098276073 12:68812582-68812604 AACAGGTAACAGGCCAAAGTTGG - Intronic
1098370045 12:69749098-69749120 AACAGGCCACAGACCACTTTAGG - Intronic
1098377346 12:69831216-69831238 AACAGGCTGCAGGCCAGATTTGG - Intronic
1098382740 12:69886145-69886167 AACAGGCAAAAAACAAAATTAGG + Intronic
1098448444 12:70591790-70591812 ATCAGGCCACAGACCAGATTTGG + Intronic
1098513747 12:71349636-71349658 AACAGGTGACAGGCCAGATTTGG + Intronic
1098571621 12:71994030-71994052 AACAGGCAATGGACCAGATTTGG + Intronic
1098985049 12:77003071-77003093 AACAGGCTGCAGGCTAGATTTGG + Intergenic
1099055995 12:77841569-77841591 ACTGGGCACCAGGCCAAATTTGG - Intronic
1099126436 12:78764005-78764027 AATAGGCAGTGGGCCAAATTTGG + Intergenic
1099346506 12:81506893-81506915 AACAGGTAGCAGGCCAGATGTGG + Intronic
1099517875 12:83621307-83621329 AACAGGCAGTGGTCCAAATTTGG + Intergenic
1099818483 12:87678733-87678755 AACAGGCAGTAGGCTAGATTTGG + Intergenic
1099980439 12:89595244-89595266 AATAGACAACAGGCTAGATTTGG + Intronic
1100144847 12:91665049-91665071 AGCAGTGAACAGGCCAGATTTGG - Intergenic
1100163977 12:91895086-91895108 AACAGGTGACAGGCTAGATTTGG - Intergenic
1100233712 12:92635980-92636002 AACAGGCCACAGTTCAGATTTGG + Intergenic
1100392706 12:94158015-94158037 AACAGGCAACAAGCCAGATTTGG + Intronic
1101051551 12:100868944-100868966 AACAGACAGCAGGCCAGATGTGG + Intronic
1101208013 12:102508208-102508230 AACAGGCAATGGGCCAGATTTGG - Intergenic
1101366289 12:104073846-104073868 AAAAGACAGCAGGCCACATTTGG - Intronic
1101814541 12:108135797-108135819 AACAGGCAGTGGGCCAGATTTGG - Intronic
1101844394 12:108350853-108350875 AACAGGCAGTGGGCCAAATCTGG - Intergenic
1101920666 12:108930033-108930055 AACAGGCAAGGGACCAGATTTGG - Intronic
1102033104 12:109754620-109754642 AGCAGCCAGCAGGCCAGATTTGG + Intronic
1102488720 12:113276008-113276030 CACAGGCCATGGGCCAAATTTGG - Intronic
1102590670 12:113954694-113954716 TACAGTCCACAGGCCAAATCTGG + Intronic
1102702977 12:114855838-114855860 AACAGTCAATTGGCCAAATTGGG - Intergenic
1102731114 12:115110726-115110748 AATAGGCAAGAGGCAGAATTTGG - Intergenic
1102817627 12:115880511-115880533 AACAGACAATAGGCCAGGTTTGG + Intergenic
1102954325 12:117049550-117049572 AACAGCCCATAGGCCCAATTTGG + Intronic
1102954328 12:117049563-117049585 AATAGATGACAGGCCAAATTGGG - Intronic
1103040288 12:117689568-117689590 AACAGTCAGCAGGCCAGATTTGG + Intronic
1103048510 12:117759250-117759272 AACAGGTACCTGGCCCAATTTGG - Intronic
1103098865 12:118154963-118154985 ACCAGGCACCAGGCTAGATTTGG - Intronic
1103265775 12:119628964-119628986 AACAGGCAGCAGGCTGGATTTGG + Intronic
1103729151 12:123014415-123014437 AAGAGGCAACTGGGCACATTGGG + Intronic
1103849188 12:123920494-123920516 AACAGGCAGCAGGCTGGATTTGG + Intronic
1103964137 12:124627351-124627373 ACCAGGCAACAGGCCAGATCTGG - Intergenic
1104578617 12:129991666-129991688 AACAGGCAACAGATCAGATTTGG + Intergenic
1105451806 13:20506792-20506814 TACAGCCCACAGGCCAAATCTGG + Intronic
1105661616 13:22502119-22502141 TACAGGCATCAGGCCAGATTTGG + Intergenic
1105953196 13:25252427-25252449 AAAAGGGAACAGGCAAAATCAGG + Intronic
1106104251 13:26719800-26719822 AACAGGAAACAGGCCACAGCAGG + Intergenic
1106199208 13:27522514-27522536 AACAGACAACAGGCCAAGTGGGG + Intergenic
1106353209 13:28954905-28954927 AACAGAGCACAGGCCAAATAAGG - Intronic
1106355094 13:28974488-28974510 AACAAGCAAAATGACAAATTAGG - Intronic
1107038535 13:35924828-35924850 AACAGGCAATGGGCCAGGTTTGG - Intronic
1107480562 13:40782348-40782370 AACAGGTGGCAGGCCAGATTTGG - Intergenic
1107780116 13:43891104-43891126 AACAGGTAAGGGGCCAGATTTGG + Intronic
1108432317 13:50366663-50366685 AGCTGGCAAAAAGCCAAATTAGG - Intronic
1108522322 13:51257667-51257689 AACAGAAAACAGGCCAATGTAGG - Intronic
1109286427 13:60414290-60414312 AACTGGTAGCAGGCCAGATTTGG - Intronic
1109559799 13:64031949-64031971 AAAAGGCAACAGTCCAAATGTGG + Intergenic
1110162546 13:72396448-72396470 AACAGGCCACGGGTCAGATTTGG + Intergenic
1110403420 13:75120956-75120978 AACAGGCAGGGGGCCAGATTTGG + Intergenic
1110444682 13:75565680-75565702 GACAGCCTACAGGCCAAATCTGG - Intronic
1111436662 13:88219776-88219798 AACAGGCACCAGCCCAAATTGGG + Intergenic
1111511842 13:89276717-89276739 AACAGGCAATTGGCTGAATTTGG + Intergenic
1111867478 13:93787423-93787445 AACGGGCAATGGGCCAGATTTGG + Intronic
1112759643 13:102679908-102679930 AACAGGCAGCAGTCCAGTTTGGG - Intronic
1113425512 13:110205031-110205053 AACAGGTAACAGAAAAAATTAGG + Intronic
1114163382 14:20193533-20193555 AATAGGCAGCAGGCCAGGTTTGG - Intergenic
1115389169 14:32834872-32834894 AACAGGCAACGAGCTGAATTTGG - Exonic
1115448125 14:33515466-33515488 AACAGGCAGCAGGCCAGATTTGG - Intronic
1115523423 14:34255593-34255615 AACAGGCCACAGGCCCAATTTGG + Intronic
1116277360 14:42852760-42852782 AACTGGCAGCAGTCCAGATTTGG + Intergenic
1116995471 14:51319293-51319315 AACAGTCAGCAAGCCAGATTAGG - Intergenic
1118147989 14:63161465-63161487 AACAGGCAGCAGGCCAGATTTGG + Intergenic
1118228542 14:63926588-63926610 AGCAAGCAGCAGGTCAAATTTGG + Intronic
1118423048 14:65628833-65628855 AACAGGCAATGAGCCAGATTTGG - Intronic
1119362862 14:74066247-74066269 AACAGGCAGGAAGCCACATTTGG - Intronic
1120614496 14:86686395-86686417 AATAAGCAGCAGGCCAGATTTGG - Intergenic
1120705521 14:87741297-87741319 AACAAGCAGCAGGCCAGACTTGG + Intergenic
1120925618 14:89794303-89794325 GGCAGGCAAGAGGCCAAGTTGGG - Intergenic
1120959998 14:90115711-90115733 AACAGGCAACAGGCCGATCTAGG + Intronic
1121075266 14:91062641-91062663 AACAGGCAATGAGCCAGATTTGG + Intronic
1121134551 14:91484389-91484411 AACAGGTGGCAGACCAAATTTGG - Intronic
1121182627 14:91941061-91941083 AACAGGGAGCATGCCACATTAGG - Intronic
1121200944 14:92117456-92117478 AACCAGCAATTGGCCAAATTTGG - Intronic
1121386112 14:93527230-93527252 AACTGGCAGCAGGCCAGATTTGG - Intronic
1121615897 14:95313458-95313480 AAGAGGCAGCAGGCCAGATTTGG + Intronic
1121750069 14:96345890-96345912 AACAGACGACAGGACCAATTTGG + Intronic
1121950826 14:98169841-98169863 AAGAGGCATCAGTGCAAATTAGG + Intergenic
1122379562 14:101292590-101292612 AACAGTCCACAGGCTGAATTTGG - Intergenic
1122621712 14:103061678-103061700 AACAAGCAGCAGGCTAAATTTGG + Intergenic
1123725319 15:23095752-23095774 AACAGGCAACAAGCCTAATATGG + Intergenic
1124078299 15:26467076-26467098 AACAGGCCAAGAGCCAAATTAGG + Intergenic
1125635865 15:41188238-41188260 AACAGTCTGCAGGCCAGATTTGG + Intronic
1125752244 15:42036795-42036817 AGCAGGCAACAGCCCAGGTTGGG + Intronic
1125826357 15:42679801-42679823 AACAGGCAGCAGACCAGATTTGG + Intronic
1125829979 15:42708315-42708337 AACAGGAAGCAGGCCAGATCTGG - Intronic
1125848292 15:42879661-42879683 AACAGTCTGCAGGCCAAATTTGG - Intronic
1125894539 15:43291603-43291625 AACAGGCAGTAGGCCACATTTGG + Intronic
1126067542 15:44837574-44837596 TTCAGGGAACAGTCCAAATTGGG + Intergenic
1126092334 15:45063307-45063329 TTCAGGGAACAGTCCAAATTGGG - Intronic
1126509199 15:49448268-49448290 AACAGGAAAGAAGACAAATTTGG - Intronic
1126614499 15:50563122-50563144 AACAGGCAACAGACCAGATTTGG - Intronic
1126666554 15:51080760-51080782 AACAGGTGGCAGGCCAGATTTGG + Intronic
1126748785 15:51854318-51854340 GACAGGCAGCAGGCCGAATTTGG + Intronic
1126934793 15:53694902-53694924 AACAGGCAGCAGGCCTGATTTGG - Intronic
1127760249 15:62132530-62132552 AACAGGAAGCAGGTCAGATTTGG + Intergenic
1128190705 15:65692926-65692948 AACAGGCCTCAGGCTAGATTTGG - Intronic
1128190906 15:65695480-65695502 AATAGGCTTCAGGGCAAATTTGG + Intronic
1128777946 15:70338021-70338043 AGCAGCAAACAGGCCAAATTTGG - Intergenic
1128994059 15:72283922-72283944 AATAGGCCACAGGCCAGATTTGG + Intronic
1129154222 15:73707740-73707762 AACAGGCCACAAGCCAGCTTTGG + Intronic
1129557514 15:76528174-76528196 AACAGGCAGTGGGCCAGATTTGG + Intronic
1129952745 15:79606515-79606537 AATAGGCAGCAGGCCCATTTTGG - Intergenic
1130325928 15:82880122-82880144 AACAGGCCATAGGCTAGATTTGG - Intronic
1130625203 15:85507285-85507307 AACAGGCAGCAGGCTAGATTTGG - Intronic
1130762738 15:86837397-86837419 TACAGCCTCCAGGCCAAATTTGG + Intronic
1130888547 15:88113673-88113695 AACAGGTGCCAGGCCAGATTTGG - Intronic
1131374084 15:91909270-91909292 AACAGGCAGCAGGCCACATTTGG - Intronic
1131517893 15:93091348-93091370 AACAGGAAACAGGCTAACCTAGG + Intergenic
1131771687 15:95744775-95744797 AACAGGCTGCAGGCTGAATTTGG + Intergenic
1131954900 15:97724192-97724214 AAAATGCAACATGCCAAAATAGG + Intergenic
1132264683 15:100459106-100459128 ACCAGGCAATAGGCTGAATTTGG + Intronic
1132447324 15:101936318-101936340 AACAGGCCAAAGATCAAATTAGG + Intergenic
1134303923 16:13015140-13015162 AACAGGCGGCAGGCCAGATTTGG - Intronic
1134555406 16:15159877-15159899 AACAGACAGCAGGCCAGAGTTGG + Intergenic
1134660776 16:15982858-15982880 AGCAGGCAGCAGGCTGAATTTGG + Intronic
1134666199 16:16020455-16020477 AACAGGCAGCAGGCCAGATTCGG - Intronic
1134683072 16:16140036-16140058 AACAGGCAAGGGGTCAGATTTGG + Intronic
1134694574 16:16214008-16214030 AACAGGCAGTGGGCCAGATTTGG - Intronic
1134775360 16:16848538-16848560 AACAGGCAACATACAAAAATGGG - Intergenic
1134847751 16:17454973-17454995 AACAGGCAAAGGACCAGATTTGG + Intronic
1134977261 16:18580629-18580651 AACAGGCAGTGGGCCAGATTTGG + Intergenic
1135062416 16:19282286-19282308 AATAGGCAAGGGGCCAGATTTGG - Intergenic
1135720010 16:24808374-24808396 AGCAGGCAGTGGGCCAAATTTGG - Intronic
1135835032 16:25817507-25817529 AATAGGCAGCAAGCCATATTTGG + Intronic
1138019311 16:53463129-53463151 CACAGGCAACAGGCCAGGTGCGG - Intronic
1139048325 16:63090848-63090870 AACAGGCAGTAGACCAAATTTGG - Intergenic
1139176672 16:64697865-64697887 TACAGGCCACAGGCTGAATTGGG + Intergenic
1139780463 16:69347275-69347297 AACAGGCAATGGGCCAGATTTGG + Intronic
1139993623 16:70960263-70960285 AACAAGCAGCAGGACAGATTTGG - Intronic
1140136711 16:72212406-72212428 AACAGGCCACAGGCTGGATTTGG - Intergenic
1140166049 16:72553106-72553128 AAGAGGTCACAGGCCAGATTTGG + Intergenic
1140261495 16:73384166-73384188 AACAGGGTGCAGGCCAGATTTGG - Intergenic
1140761549 16:78113475-78113497 AACAGGCAGTGGGCCAGATTTGG + Intronic
1140825113 16:78699160-78699182 AACAGGTCACGGGCCACATTTGG + Intronic
1141019407 16:80480794-80480816 AATAGGCAATGGGCCAGATTTGG + Intergenic
1141885162 16:86886693-86886715 AACAGGCAGCAGGCAAGATTTGG - Intergenic
1142897012 17:2987144-2987166 CACAGGCAGCAGGCCAGACTTGG + Intronic
1143753987 17:9053079-9053101 AACAGGCAACAGACAGAATTTGG - Intronic
1143823039 17:9580146-9580168 AACAGGCAGTGGGCCAGATTTGG - Intronic
1144294601 17:13861639-13861661 ATCAGGCTACAGGCCAGATTTGG + Intergenic
1144513046 17:15894000-15894022 AACAGGCTATAAGCCAGATTTGG + Intergenic
1145986116 17:29047748-29047770 AACAAGCAGAAGGCCAGATTTGG + Intronic
1146113531 17:30113389-30113411 ACCAGGCAGCTGGCCAGATTTGG - Intergenic
1146119638 17:30180757-30180779 AACAGGCAACAGGCCAGATTTGG + Intronic
1146528455 17:33587053-33587075 AACAGGCAACAGGCTGGATTTGG - Intronic
1146640819 17:34540100-34540122 AACAGGTGGCAGGCCAGATTTGG + Intergenic
1146831608 17:36074315-36074337 AACAGGTAGTAGGTCAAATTGGG - Intergenic
1147329019 17:39685603-39685625 AACAGGAAACAAGCCACAGTAGG + Intronic
1148402089 17:47372964-47372986 AACAGAAAACAATCCAAATTTGG - Intronic
1148923418 17:51060616-51060638 GATAGGCAAAAGGCCATATTAGG + Intronic
1148978798 17:51553114-51553136 AACAGGCAGAGGGCCAGATTTGG - Intergenic
1148983072 17:51596038-51596060 AACAGGCAGTGGGCCAGATTTGG + Intergenic
1149030282 17:52074808-52074830 AACAGGCAATGGGCCATATTTGG - Intronic
1149234690 17:54576342-54576364 AAAAGGCAACAGGCAATATAGGG + Intergenic
1149573409 17:57693875-57693897 AATAGGCAACAGGCCTGATTTGG - Intergenic
1149777229 17:59367536-59367558 AACAGGTGAAAGGCCCAATTAGG + Intronic
1149786900 17:59443331-59443353 AACAGGCAGCAGTCCAAATTTGG + Intergenic
1150026865 17:61685242-61685264 AACAGGCAGCAGGCCAAATTTGG + Intronic
1150056931 17:62025703-62025725 AACAGGCAGTGGGCCAAATATGG + Intronic
1150192746 17:63260425-63260447 AACAGGTAGCAGGCCATATTTGG + Intronic
1150927401 17:69547457-69547479 ACCAAGCAATGGGCCAAATTTGG + Intergenic
1151142096 17:72003432-72003454 AACAGGCTGCGGGCCTAATTTGG + Intergenic
1151168584 17:72226167-72226189 TACAGGCAATAGGCTGAATTTGG - Intergenic
1151669968 17:75566625-75566647 AATAGGCAGGAGGCCAGATTTGG + Intronic
1152507561 17:80760624-80760646 AACAGGCAGTTGGCCAGATTTGG + Intronic
1152995147 18:399673-399695 AACAGGTAACAGCACAAAGTAGG - Intronic
1153033590 18:737664-737686 AACAGGCTGCAGGCCACTTTTGG - Intronic
1153141305 18:1975461-1975483 AAGAGGCAACAGGCCATATTTGG + Intergenic
1153397374 18:4639889-4639911 AACAGCCAAGAAGCCAAATTTGG + Intergenic
1153443461 18:5146841-5146863 AACAGACCACAGGCCAGATTTGG + Intronic
1154046344 18:10908975-10908997 AACAGGCAGCAGGCAGGATTTGG - Intronic
1154177924 18:12099064-12099086 AACAAGTAACAAGCAAAATTAGG + Intronic
1155087897 18:22475413-22475435 AGTAGGCAACAGGCCATATTTGG - Intergenic
1155353078 18:24925441-24925463 AGCAGGCCACAGGCTAGATTTGG - Intergenic
1155833043 18:30542298-30542320 AACAGGCTGCAGGCTGAATTTGG - Intergenic
1155901097 18:31391634-31391656 AACAGACAGCAAGCCAGATTTGG - Intronic
1156402741 18:36755558-36755580 AACATGCAACACACCAAAATGGG - Intronic
1156877066 18:42027591-42027613 AACAGGCAACAGGCTGAATTTGG - Intronic
1156904569 18:42337730-42337752 AACAGGCAACAGGCAGAGTTTGG - Intergenic
1157018631 18:43751084-43751106 AACAAGCAACAGGCCAGATTTGG + Intergenic
1157268902 18:46254470-46254492 AACAGGCAGCAGGCCAGAATTGG - Intronic
1157534088 18:48445829-48445851 AACAGGCAACGGACCAGATTTGG + Intergenic
1157632266 18:49110037-49110059 AACAGACAACAGGCCAGATTTGG - Intronic
1157696982 18:49730757-49730779 AACATGCAACAAGCTATATTCGG - Intergenic
1157901739 18:51524594-51524616 AACAGACAGCAGGCCCAATTTGG - Intergenic
1157938348 18:51897867-51897889 AACAGGCAACTGGCCCGATTTGG + Intergenic
1158011878 18:52737978-52738000 AACAGGCAGAGGGCCAAAGTTGG - Intronic
1158210633 18:55045643-55045665 AACAGGCAGCAGATCAGATTTGG - Intergenic
1158947847 18:62463457-62463479 AACAGGCAGCTGGCCTGATTTGG + Intergenic
1160098611 18:75899851-75899873 ACCAGGCAGTAGGCCAGATTTGG - Intergenic
1160637950 19:96215-96237 AACAGGCCAAAGATCAAATTAGG - Intergenic
1161743992 19:6043522-6043544 AACAGGCAGTGGGCCAGATTTGG - Intronic
1162084200 19:8238596-8238618 AGCAGGCACCAGGCCAGAGTTGG + Intronic
1162882585 19:13671085-13671107 AACAGGCAGCCAACCAAATTTGG + Intergenic
1163409172 19:17142835-17142857 AACAAGCATCAGACCAGATTTGG + Intronic
1163864992 19:19765838-19765860 AACAGGCAACAGGCCGGGTGTGG + Intergenic
1164850701 19:31481019-31481041 AATAGGCAGCGGGCCAGATTTGG + Intergenic
1165292913 19:34903902-34903924 AACAGACTATAGGCCACATTTGG + Intergenic
1167711013 19:51110935-51110957 AACAGGCAGCAGGCCCGATTTGG + Intergenic
1168411835 19:56145095-56145117 AACAGGCTGCAGGCCAGATTCGG + Intronic
925737196 2:6973762-6973784 AACAGGCAGCAGGCTGGATTTGG - Intronic
926620527 2:15043020-15043042 AACAGGCAGTAGGTCACATTTGG + Intergenic
927832741 2:26367448-26367470 AATAGGCTACACACCAAATTTGG - Intronic
928140881 2:28727932-28727954 AACAGGCTCCTGGCCACATTTGG - Intergenic
928243475 2:29606628-29606650 AACAGGCAATGGGCCAGATTAGG - Intronic
928649866 2:33392615-33392637 AATAGGTAGCAGGCCAGATTTGG + Intronic
928791097 2:34954979-34955001 AAAAGGTAACAGGTCAGATTTGG - Intergenic
928983888 2:37161814-37161836 AACAGGCAGCAGCCCAGTTTTGG - Intergenic
929093865 2:38245747-38245769 TACAGGCTCCAAGCCAAATTCGG + Intergenic
929196433 2:39189605-39189627 AACAGGCAGTAGGCCAGATTTGG - Intronic
929209879 2:39344290-39344312 ATCAGGCAGCAGGCTAGATTTGG - Intronic
929258297 2:39838238-39838260 CACAGGCACCAGGCCTAATGAGG + Intergenic
929470806 2:42190951-42190973 AACAGTTGACAGGCCAGATTTGG + Intronic
929987992 2:46756467-46756489 AACAGGCCACAGGCCAGATTTGG + Intronic
930022569 2:47010357-47010379 AACAGTTCACAGGCCAAATCTGG - Intronic
930163439 2:48180795-48180817 AGCAGGCAGCAGGCTGAATTTGG - Intergenic
930165213 2:48197541-48197563 AATAGGCAATGGGCCAGATTTGG - Intergenic
930231583 2:48848965-48848987 AACAGGCAACAAACTAGATTTGG - Intergenic
930754821 2:54963604-54963626 AACAGGCCACAGGCCCGATCTGG - Intronic
930875907 2:56215808-56215830 AACAGGCAACAGGCTAAATGTGG - Intronic
931119926 2:59205086-59205108 AACAGGCATCAGGTCTGATTTGG + Intergenic
931190949 2:59999733-59999755 TACAGCCTACAGTCCAAATTCGG + Intergenic
931587766 2:63846754-63846776 AATCAGCAACAGGCTAAATTTGG - Intronic
931635307 2:64335596-64335618 AACAGGAAGAAGGCCAGATTTGG + Intergenic
931830541 2:66046414-66046436 AACAGACAAAAGGCCAATTCTGG - Intergenic
932529839 2:72517336-72517358 AACAGGCAACAGGCTGGATTTGG + Intronic
932806738 2:74791060-74791082 AACAGGCAGCAGGCTGGATTTGG + Intergenic
932848153 2:75155900-75155922 AATAGGCAGCAGGCCAGCTTTGG - Intronic
933189523 2:79318670-79318692 AACAGGCAGCAGGCTAGATTTGG - Intronic
933462523 2:82607175-82607197 AACAGGCAACAAGCTAGATTTGG - Intergenic
933979036 2:87535719-87535741 AACAGGCAGAGGGCCAGATTTGG + Intergenic
934024974 2:87994637-87994659 AACAGGATACAAGCCAGATTTGG - Intergenic
934648806 2:96075576-96075598 AGCAGGCAGCAGGTCAAATTTGG + Intergenic
934862672 2:97777417-97777439 AACAGACTGCAGGCCAGATTTGG - Intronic
935604992 2:104962540-104962562 AAAAGACAACAGGCCAGATGCGG - Intergenic
935607514 2:104985515-104985537 AAGAGTCAACAGCTCAAATTAGG + Intergenic
935776049 2:106472728-106472750 AACAGGATACAAGCCAGATTTGG - Intergenic
935980819 2:108625130-108625152 AAAAGGCAGCAGGCCAGATTTGG - Intronic
936314791 2:111415073-111415095 AACAGGCAGAGGGCCAGATTTGG - Intergenic
938686177 2:133740658-133740680 AACAGGCAACTAGCTAAATGTGG - Intergenic
938748261 2:134302196-134302218 AACAGGCAGTGGGCCAGATTTGG + Intronic
939259345 2:139787140-139787162 AACAGGCAGCATGCCCGATTTGG - Intergenic
939409489 2:141805667-141805689 AATAGGCCACAGGTCAGATTTGG - Intronic
939457766 2:142460597-142460619 AACAGGCAGCTAGCTAAATTTGG + Intergenic
940413724 2:153396077-153396099 ATCAGGCAGCAGGCTAAATTTGG + Intergenic
940450753 2:153833722-153833744 AACAAGCAGCAGGCCAGATTTGG + Intergenic
940996990 2:160160063-160160085 AACAAGCAACAGGCCAAATATGG - Intronic
941494957 2:166188399-166188421 TGCAAGCACCAGGCCAAATTAGG + Intergenic
941677483 2:168359241-168359263 AACAGACAGCAAGCCAGATTAGG - Intergenic
942040732 2:172059675-172059697 AACAGTCAGCAGTCCAGATTTGG + Intronic
942866443 2:180681290-180681312 AACAGATAGCAGGCAAAATTTGG - Intergenic
942936745 2:181566382-181566404 AACAGGCACCAGGACAAATTGGG - Intronic
942994373 2:182243476-182243498 AACAGGAAGGAGGCCAAATGTGG + Intronic
943251886 2:185533348-185533370 AATAGGCTATAGGCCATATTTGG - Intergenic
943626319 2:190205036-190205058 AACAGGCAGCAGGCTGGATTTGG + Exonic
943652046 2:190467672-190467694 AACAGGCAGCAGGCCAGATTTGG - Intronic
944487580 2:200223006-200223028 AACAGGCAGCGGGCCAGGTTTGG + Intergenic
944611925 2:201419243-201419265 GACAGCCCACAGGCCAACTTCGG + Intronic
944612362 2:201424561-201424583 AACAGGTGGCAAGCCAAATTTGG - Intronic
945138003 2:206650482-206650504 AACAGGGAGCAAGCCGAATTTGG + Intergenic
945575062 2:211520430-211520452 AACAGGCCACGGGCTAGATTTGG - Intronic
945712196 2:213312022-213312044 ATCAGGAAGCAGGCCAGATTTGG - Intronic
946004216 2:216509263-216509285 ACCAGGTAACAGGCAAAATGAGG - Intronic
946290304 2:218739328-218739350 AGCAGGCAACAAGCAAGATTTGG - Intronic
946350703 2:219149913-219149935 AACAGGCAGCAAGCCAGAATTGG + Intronic
946842100 2:223829289-223829311 AACAGGCAGAAGGCCAGATTTGG - Intronic
947111893 2:226727455-226727477 AACAGGCAGCAGGCTGGATTTGG + Intergenic
947190888 2:227503466-227503488 AACAGGCAACAGGCCAAATTTGG - Intronic
947482645 2:230515314-230515336 AACAGGAAAAAGGCCAAAGGAGG - Intronic
947699787 2:232223074-232223096 AACACACAACAGTCCAAATTCGG - Intronic
948228287 2:236330243-236330265 AACAGACAACAGGCCAAATTTGG - Intronic
948240706 2:236430995-236431017 AACAGGCACCAGGCCAGATTTGG - Intronic
1168781593 20:496210-496232 GGCAGACCACAGGCCAAATTTGG + Intronic
1168781595 20:496223-496245 AGCAGACATCAGGCCAAATTTGG - Intronic
1168866224 20:1089329-1089351 AACAAGCAGCAGGCCAGATTTGG + Intergenic
1169034090 20:2435623-2435645 AACAGGTGGCAGGCCAAGTTTGG + Intergenic
1169104018 20:2978844-2978866 AACAGGCAGTGGGCTAAATTTGG + Intronic
1169109799 20:3025046-3025068 AGCAGGCAGCAGGCCAGATTTGG + Intronic
1169745864 20:8942185-8942207 AACAGGTTATGGGCCAAATTTGG - Intronic
1169809030 20:9590387-9590409 AACAGGCAGAGGGCCAGATTTGG - Intronic
1169837910 20:9900941-9900963 AAGAGGCAGCAGGCCAGATTTGG - Intergenic
1170092949 20:12612523-12612545 AAGAGGCAGCAGGCCAGGTTTGG - Intergenic
1170155387 20:13264512-13264534 ACCAAGCCACAGGGCAAATTAGG - Intronic
1170187605 20:13608721-13608743 ACCAGGCATCTGGCCAGATTTGG + Intronic
1170853345 20:20023982-20024004 AACAGGCAGTGGGCCAGATTTGG - Intronic
1171255524 20:23686638-23686660 AACAGGCAACACCCCAAAGCAGG + Intronic
1171262863 20:23748563-23748585 AACAGGCAACACTCCAAAGCAGG + Intronic
1171271992 20:23824767-23824789 AACAGGCAACACCCCAAAGCAGG + Intronic
1172512161 20:35508278-35508300 AACAGGCAGCAGGCTGGATTTGG - Intronic
1173150674 20:40564159-40564181 AACAGGCAGTGGGCCAGATTTGG + Intergenic
1173159623 20:40642808-40642830 AAAAGGCAGTAGGCCACATTTGG + Intergenic
1173451107 20:43164891-43164913 AACAGGCAGCAGGCCAGATCTGG + Intronic
1173877413 20:46383009-46383031 AACAGGCAACAGGCCTAATATGG - Intronic
1173971993 20:47160400-47160422 AACAGGCGACAGGCCAGATTTGG + Intronic
1174190053 20:48734217-48734239 AACAGGCAGAGGGCCAGATTAGG - Intronic
1174529304 20:51198460-51198482 ATCAGGCCACAGGCCAAACCTGG - Intergenic
1174543732 20:51309289-51309311 AACAGGCAGTGGGCCATATTTGG - Intergenic
1174785183 20:53425863-53425885 AACAGGTAGCAGGCTGAATTTGG + Intronic
1174792906 20:53497130-53497152 AACAAGTAGCAGGCCAAATTTGG + Intergenic
1174809941 20:53637026-53637048 AACAGGCAATAGGCTGGATTTGG - Intergenic
1174937889 20:54892520-54892542 AACAGGCAGCAGACCTAATTCGG - Intergenic
1175125449 20:56748007-56748029 AACAGACATCTGGCCAGATTTGG - Intergenic
1175267816 20:57713255-57713277 AACAGGCCAAAGGCCAGAGTTGG + Intergenic
1175435198 20:58942092-58942114 AACAGGTGGCAGGCCAGATTTGG + Intergenic
1175608884 20:60333746-60333768 ATCAGGCAATAGACCCAATTTGG + Intergenic
1175760889 20:61561613-61561635 AACAGGCAGCAGGCCAGATTGGG - Intronic
1177406525 21:20674685-20674707 AACAGACAGCAGGCCAGATTTGG + Intergenic
1177594561 21:23220870-23220892 AACAGAAAACATTCCAAATTTGG - Intergenic
1177607986 21:23407156-23407178 AACAGGCAGCAAGCCAGATTTGG + Intergenic
1177865854 21:26512543-26512565 AACAGGCAGCAGACCAGATCTGG - Intronic
1177925107 21:27204354-27204376 AACAGGCAGCAGGCCAGATTTGG - Intergenic
1178604023 21:34019535-34019557 AACAGGCAATGGGCCAGATTTGG - Intergenic
1178891824 21:36526308-36526330 AACAGGCAGCAGGGCAGGTTTGG + Intronic
1178926211 21:36777406-36777428 AACTGGCAGCAGGCCAGACTCGG + Intronic
1179182051 21:39053889-39053911 AACAGGCAGTGGGCCAGATTTGG - Intergenic
1179184886 21:39077976-39077998 AACAGACAAAGGGCCAGATTTGG + Intergenic
1179393326 21:41013806-41013828 AACAGGCAGCTGGCCAAACTTGG + Intergenic
1179411140 21:41164260-41164282 AACAGGCAGTTGGCCAGATTTGG + Intergenic
1179415490 21:41195081-41195103 AACAGGTAGCTGGCCAGATTTGG - Intronic
1179420739 21:41234386-41234408 AACAGGCAGCAGGTCAGATTTGG - Intronic
1179943873 21:44657506-44657528 AACAGGCAGTGGGCCAAATGTGG + Intronic
1181914009 22:26264760-26264782 TACAGCCCACTGGCCAAATTTGG - Intronic
1182010018 22:26992851-26992873 AACAGGCAGTGGGCCAGATTTGG - Intergenic
1182130464 22:27846533-27846555 AACAGGCAGCAGGCCAGATTTGG - Intergenic
1182612662 22:31562121-31562143 AACAGAAAGCAGGCCAAATTTGG - Intronic
1182891422 22:33822095-33822117 ACCAGGCATCAGGCCAAGGTTGG - Intronic
1183026740 22:35070996-35071018 AACAGGGGTCAGGCCAGATTTGG + Intronic
1185276369 22:49951700-49951722 GCCAGGCCCCAGGCCAAATTTGG - Intergenic
949121661 3:391955-391977 AACAGGCAGCAGGCTGAATTTGG - Intronic
949129877 3:487085-487107 AACAGGAAACAGGTCAGATAAGG - Intergenic
949168991 3:976232-976254 AACAGGCGGCCTGCCAAATTTGG + Intergenic
949345593 3:3073379-3073401 AACAGGCAACAAGCCAGATTTGG - Intronic
949691008 3:6639145-6639167 AACGGGCAAAAGACCAAAATAGG + Intergenic
950159380 3:10748249-10748271 AACAGGCAGTGGGCCAGATTTGG + Intergenic
950968793 3:17166098-17166120 AACAGGCCACAGGCTGGATTTGG - Intronic
951035243 3:17925555-17925577 AACAGGGAGGAGGCAAAATTTGG + Intronic
951055850 3:18145566-18145588 AACAGGCAGCAGGCCCCGTTTGG - Intronic
951072002 3:18339946-18339968 AACAAGTGGCAGGCCAAATTGGG + Intronic
951106910 3:18755055-18755077 AACAGGCAGTAGGCCATATTTGG - Intergenic
951341381 3:21491624-21491646 AACAGGCAGCAAGCCTACTTTGG - Intronic
951587114 3:24226777-24226799 AACAGGCAGCAGGTCAGCTTTGG - Intronic
951703419 3:25520007-25520029 AACAGGCAGCAGGCCAGATTTGG - Intronic
951801520 3:26601890-26601912 AACAAGCAGCAGGCAATATTTGG - Intergenic
951983588 3:28592975-28592997 AACAGGCATTAGGACCAATTTGG + Intergenic
951989938 3:28665184-28665206 AACAGTCCACAGGCCAGATGTGG - Intergenic
952037389 3:29219453-29219475 AACAGGTGGCAGGCCAGATTTGG + Intergenic
952085799 3:29819403-29819425 AACAGATAACAGACCAGATTTGG + Intronic
952147907 3:30553485-30553507 AATAGGCAAAGGGCCAGATTTGG + Intergenic
952240215 3:31524488-31524510 AACAGGCAGCAAACCAGATTCGG - Intergenic
952283278 3:31944070-31944092 AATATGCAACAGCCTAAATTGGG - Intronic
952337075 3:32413042-32413064 AACAGGTGGCAGGCCAGATTTGG - Intronic
952353629 3:32564380-32564402 AACAGGCAGCAAGCCAGTTTTGG - Intronic
954039487 3:47874047-47874069 AAGAGGCCACTGGCCAAATCTGG + Intronic
954970540 3:54648178-54648200 AGCAGGCAATGGGCCAGATTTGG - Intronic
954975110 3:54686144-54686166 AATAGGCAGCAGGCCAGACTTGG - Intronic
955037930 3:55286946-55286968 AAAGGGCAGCAGGCCAGATTTGG + Intergenic
955144733 3:56305767-56305789 AGCAGGCAAAAGGCCAGATTTGG - Intronic
955358768 3:58254293-58254315 TACAGCCTACAGGTCAAATTTGG + Intronic
955499603 3:59570755-59570777 AATAGACCACAGGCCAAATTTGG - Intergenic
955511833 3:59688840-59688862 AACAGGCTGTGGGCCAAATTTGG + Intergenic
955591723 3:60543233-60543255 AACAGGCAGCAGCCCAGATTTGG + Intronic
955794249 3:62619011-62619033 ACCAGGCAATAGGCCAGAATTGG - Intronic
955830308 3:62994520-62994542 AACAGTCCACAGGCCAGATTTGG + Intergenic
955842130 3:63123862-63123884 AACAGCCAACAGGCAGATTTGGG - Intergenic
955894642 3:63686351-63686373 AATAGGCAATGGGCCAGATTTGG + Intergenic
955960054 3:64331332-64331354 AACAGCCTAGAGGCCAAATTTGG - Intronic
956200620 3:66701826-66701848 AACAGGTGGCAGGCCAGATTTGG - Intergenic
956212067 3:66812302-66812324 AACAGGCAGCAGGCCAAGTTTGG + Intergenic
956371053 3:68562222-68562244 AACAAGCAGCAAGCCAGATTTGG + Intergenic
956524008 3:70137336-70137358 AATAGGCAACAGGACAAATTTGG - Intergenic
956686412 3:71832691-71832713 AACTGGCAGCAGGCTAGATTTGG - Intergenic
956721175 3:72118875-72118897 CAGAGGCAGCAGGCCAGATTTGG - Intergenic
956732926 3:72213454-72213476 AACAGGCTGCAGGCCAAATTCGG - Intergenic
956770079 3:72518166-72518188 AACAGGCAGCAGGCCAGATTTGG + Intergenic
956865499 3:73364992-73365014 AACAGGCATCAGGCTGGATTTGG - Intergenic
956991233 3:74768215-74768237 AACAGGCAGCAGGCTGGATTTGG + Intergenic
957110326 3:75947377-75947399 AACAGGCAGCAGGCCAGATCTGG - Intronic
957134372 3:76266334-76266356 AACAGGCAAGGGGCATAATTTGG - Intronic
957551116 3:81706213-81706235 AAAAGGCTGCAGGCCAAATCTGG - Intronic
957951872 3:87137759-87137781 TTCAGGCAAGAGGCCAATTTGGG - Intergenic
958072466 3:88632105-88632127 AACAGATAATGGGCCAAATTGGG + Intergenic
958519615 3:95168194-95168216 CACAGGGAACAGGCCATATGAGG + Intergenic
958982936 3:100745776-100745798 AACAGGCAATAGTCCAGATTTGG - Intronic
959627224 3:108466121-108466143 AACAGGCTGCAGGCTAGATTGGG + Intronic
959890753 3:111552673-111552695 AATAGGCAACAAGCCAGATTTGG + Intronic
960263655 3:115595979-115596001 AATAGGTAGCAGGCCAAATTTGG - Intergenic
960670459 3:120150844-120150866 AACAGGCAGCAGGCTAGATTTGG + Intergenic
960735760 3:120778101-120778123 AACAGGCAAGAAGCCAAGTTGGG - Intronic
960765577 3:121126211-121126233 AACAGGCAGCATGCCAGATTTGG - Intronic
960825756 3:121782474-121782496 AACAGGCAGCAGGCTGGATTTGG - Intronic
961472328 3:127123710-127123732 AATAGGCAACAGGCCAGATTTGG + Intergenic
961776016 3:129286117-129286139 AACAGGCAGTAGGCCAGATTTGG - Intronic
962208678 3:133457656-133457678 AACAGGCAATGGGTCAGATTTGG - Intronic
962502169 3:136006584-136006606 AACAGGCAGTGGGCCAGATTTGG + Intronic
962563268 3:136630580-136630602 AAGAGACAACATGCCATATTTGG + Intronic
962964971 3:140345107-140345129 AAAAGGCAAAAGGGCAAATGAGG - Intronic
963081415 3:141398135-141398157 AACAGGTATCAGGCCAGATGTGG + Intronic
963099429 3:141585067-141585089 AACAGGCTACAGGTCAAACGTGG + Intronic
963776040 3:149441767-149441789 AACATGAAACAATCCAAATTTGG + Intergenic
964006250 3:151832825-151832847 AACAGGCAAGAGGTTGAATTTGG - Intergenic
964441964 3:156721069-156721091 GATAGGCAGCAGGCCAGATTTGG + Intergenic
964517562 3:157529315-157529337 ATCAGGCAACTGGCTGAATTTGG + Intronic
964765727 3:160177108-160177130 AACAGGCAGAAGTCCAGATTTGG - Intergenic
965829255 3:172765425-172765447 GACAGGGAAGAGGACAAATTTGG - Intronic
965984206 3:174732034-174732056 AACAGGCATCCGGCCAAATTTGG + Intronic
966419844 3:179726616-179726638 GCCAGGCACCAGGCCAAGTTCGG - Intronic
966421550 3:179739275-179739297 AACAGGCAGCAGGGCAACTCTGG - Intronic
966672518 3:182543729-182543751 AATAGGCAGCAGGCTAGATTTGG + Intergenic
967654660 3:192032578-192032600 AACAGGCAGTGGGCTAAATTTGG - Intergenic
969230551 4:5827302-5827324 CACAGGCAGCAGGCCATATGAGG - Intronic
970568631 4:17357418-17357440 AATAGGTAGCAGGCCAGATTTGG - Intergenic
970854867 4:20639463-20639485 AATAGGCAGCAAGCTAAATTTGG + Intergenic
971059937 4:22956500-22956522 AGCAGGCCACAGGCCATATTTGG + Intergenic
971228591 4:24778755-24778777 AAAAGGCACCAGACCAAACTTGG - Intergenic
971614601 4:28771701-28771723 GACATGGAACAGACCAAATTTGG - Intergenic
972119020 4:35677775-35677797 AACAGGCAACCTACAAAATTGGG - Intergenic
972297017 4:37749149-37749171 AACAGGCAGCAGACCCTATTTGG - Intergenic
972586726 4:40444361-40444383 AACAAACAGCAGGCCATATTTGG - Intronic
972797539 4:42436891-42436913 AATAGGCAACAGCACAATTTAGG + Intronic
973208558 4:47588406-47588428 ATCAGACAGTAGGCCAAATTTGG - Intronic
973827000 4:54718070-54718092 AACAGGCTACAGGCCAATTCTGG - Intronic
974865408 4:67574656-67574678 ATCAGGCCATAGGCCAGATTTGG - Intronic
974870995 4:67641680-67641702 AATAGGCAGCATGCCTAATTAGG - Intronic
975328696 4:73089383-73089405 AACAGGCAGCAGGCCAAATTTGG + Intronic
976084146 4:81389926-81389948 AACAGGCAGCAGGCCAGACTTGG + Intergenic
976121328 4:81785594-81785616 AACAGGAAGCTGGCCACATTTGG + Intronic
976126260 4:81836552-81836574 AACAGGCAATCGGCCAGATTTGG + Intronic
979357752 4:119725473-119725495 AACAGGCAGCAGGCTGGATTTGG - Intergenic
979841139 4:125441930-125441952 AACAGGCACTAGGCCCAATTTGG - Intronic
979934705 4:126677031-126677053 AACAGGTAGCAGGCCAGATTTGG + Intergenic
979975736 4:127194197-127194219 AACAGGAAGCGGGCCAAATTTGG + Intergenic
980213937 4:129826866-129826888 AACAGGCGGTAGGCCAGATTTGG - Intergenic
980959171 4:139457704-139457726 AACAGGCAAAAGACCATTTTTGG - Intronic
981124921 4:141094621-141094643 AACAGGCCTCAGGCCAGATTTGG + Intronic
981226159 4:142297156-142297178 ATCAGGCAACATGCCAGAGTTGG - Intronic
982050551 4:151497369-151497391 AACAGGTGACTGGCCAAATTTGG - Intronic
983671976 4:170247831-170247853 GACAGGCAATAGGCCAGATTTGG - Intergenic
983888661 4:173008475-173008497 ATCAGGCAACAGGCCTATTATGG - Intronic
984000738 4:174239981-174240003 AGCAGGCAGCAGGCCAGATCTGG - Intronic
984155185 4:176187653-176187675 AACAGGCAACAGGCTGAATTTGG + Intronic
985380017 4:189383545-189383567 ACCAGAGAATAGGCCAAATTTGG + Intergenic
985858653 5:2451318-2451340 AGCAGGCAGCTGGCCAGATTTGG + Intergenic
986096118 5:4555550-4555572 AACAGGCAACAGCCCCAGCTCGG + Intergenic
986286462 5:6362765-6362787 AGCAAGGAATAGGCCAAATTGGG + Intergenic
986341092 5:6790048-6790070 AACAGGCAACAGGTCAGATTTGG - Intergenic
986448874 5:7847602-7847624 AATAGGCAACTGGCCAGATTTGG + Intronic
986478012 5:8155315-8155337 AACAGGTAGTAGGCCATATTGGG - Intergenic
987287431 5:16471073-16471095 AACAGGTAGCAGGCCAGATTTGG + Intergenic
987607817 5:20160827-20160849 TGCAGGCTGCAGGCCAAATTAGG + Intronic
987669246 5:20985994-20986016 AACAGACAAAAGGCCAAATTTGG - Intergenic
988430457 5:31112975-31112997 AAAAGGCAACCAGCCAAAGTAGG - Intergenic
988555583 5:32233137-32233159 AACAGGCGCCAGGCCAGATTTGG - Intronic
988678793 5:33463108-33463130 ATCAGGCAAAAGGCTAAAGTAGG - Intronic
989242925 5:39220811-39220833 AACATTCCACAGGCCAGATTTGG - Intronic
989437717 5:41434172-41434194 AGCAGCCAACAGGGCAAACTAGG - Intronic
989549437 5:42716541-42716563 AACATGTGACAGGCCAGATTTGG + Intronic
990428091 5:55708878-55708900 ATCTGTCAGCAGGCCAAATTTGG + Intronic
990433591 5:55764248-55764270 AGATGGCAACAGGCCAAATTAGG - Intronic
990958160 5:61364365-61364387 AACAGGTGGCAGGCCAGATTTGG - Intronic
990980509 5:61598628-61598650 AGCAGGCAGCAGACCAGATTTGG - Intergenic
991343717 5:65640136-65640158 AACAGACAATGGACCAAATTTGG - Intronic
992035637 5:72772541-72772563 AACAGGTGGCAGGCCAGATTAGG + Intergenic
992570016 5:78045893-78045915 AATAGGCAGCAGGCCATATTTGG - Intronic
992594087 5:78328028-78328050 AACAGGCATTGGGCCAGATTTGG + Intergenic
993090167 5:83415801-83415823 AACAGGCTGCGGGCCAGATTTGG - Intergenic
993254213 5:85566730-85566752 AATAGTCCACAGGCCAGATTTGG - Intergenic
993483312 5:88451205-88451227 AACAGGCAACAGGTGGAATCTGG - Intergenic
994848020 5:105015517-105015539 AACAGGCCACAGGCCTGTTTTGG + Intergenic
994900894 5:105767878-105767900 GACAGGCATCAGGCCAGATTTGG - Intergenic
995169833 5:109094720-109094742 AACAGGCAATAGGCTGGATTGGG + Intronic
995853092 5:116567208-116567230 AACAGGAAACAGGGAAACTTTGG - Intronic
996124917 5:119713357-119713379 AACAGGAGGCAGGCCATATTTGG + Intergenic
997841975 5:137250016-137250038 AACAGGTGGCAGGCCAGATTTGG - Intronic
997904594 5:137803802-137803824 AATAGGAAAATGGCCAAATTTGG - Intergenic
998423734 5:142010143-142010165 TAAAGGCCGCAGGCCAAATTTGG - Intronic
998790494 5:145761738-145761760 AGCAGGCAGCCGGCTAAATTTGG + Intronic
998852280 5:146362760-146362782 AACAGGCAGCAGGCCAGCTTTGG + Intergenic
998871031 5:146551901-146551923 AACAGGCAGCAGGCTGGATTTGG + Intergenic
999942345 5:156557488-156557510 AACAGGTCACAGGCTGAATTTGG - Intronic
1000618314 5:163455064-163455086 AACAGGTAGTGGGCCAAATTTGG + Intronic
1000653297 5:163844949-163844971 AATAGGCAAGGGGCCAGATTTGG - Intergenic
1000950885 5:167481256-167481278 AACAGGCAGCAGGCCATATTTGG - Intronic
1001006048 5:168051289-168051311 AACAGGCAGCTGGCCAGATTTGG - Intronic
1001010379 5:168092333-168092355 AACAGGCAGTGGGCCAGATTAGG - Intronic
1001014603 5:168128694-168128716 AACAGGCAGCAGGCCAGATTTGG - Intronic
1001149588 5:169215616-169215638 AGCAGGCAGTGGGCCAAATTTGG + Intronic
1001220786 5:169898813-169898835 AACAGGTAGCAGGCAAGATTTGG + Intronic
1001709791 5:173769084-173769106 AACAGGCAAGGGGCCAGATTTGG - Intergenic
1002357661 5:178643844-178643866 AACAGTCAGCAGGCCAGATTTGG - Intergenic
1002838944 6:889264-889286 AACAGGCAGCAGGATGAATTTGG - Intergenic
1003026587 6:2560300-2560322 AACAGGCTTCAGGCCAAATGTGG - Intergenic
1003264678 6:4554793-4554815 AACAGGGAATAGACCAGATTGGG - Intergenic
1003304447 6:4913850-4913872 AACAGGAAGCAGCCCAGATTTGG + Intronic
1004206910 6:13599624-13599646 AACAGGTAGCAGGCCCAATGTGG - Intronic
1004568710 6:16824137-16824159 AACAGGCAGCAGGCCAGAATTGG - Intergenic
1004835313 6:19524465-19524487 AACAGGCAACAGGGCAGATTTGG - Intergenic
1005489945 6:26338527-26338549 AACAGGTAGCAGGCCACATTTGG - Intergenic
1008239687 6:49094345-49094367 AGCAGGCACCAGGCCATGTTTGG + Intergenic
1008453563 6:51681725-51681747 TACAAGCCACAGGCCAAATCAGG + Intronic
1009276104 6:61682497-61682519 AACAATCAGCTGGCCAAATTTGG - Intronic
1010129621 6:72475629-72475651 AATAGGCAACAGAACAAATTTGG - Intergenic
1010416082 6:75613149-75613171 AACAGGCAGCTGGACAAATTTGG - Intronic
1010421223 6:75678416-75678438 AACAAGAAACAGGCAAAACTAGG - Intronic
1010437344 6:75849138-75849160 AACAGGCAGTGGGTCAAATTTGG - Intronic
1010735044 6:79434762-79434784 AACAGGCAGCGGGCTGAATTTGG - Intergenic
1011685749 6:89822137-89822159 AACAGCCAGGAGGCAAAATTTGG + Intergenic
1012305514 6:97652427-97652449 AACAAGCAACTGGCCAGGTTTGG + Intergenic
1012467778 6:99534687-99534709 AACAGGTAGCAGGTCAGATTTGG + Intergenic
1012837067 6:104282291-104282313 AACAGGTAGCAGTCCAAACTGGG + Intergenic
1013258955 6:108418241-108418263 AACAGGCAGCAGGCCAGATTTGG - Intronic
1013416813 6:109932912-109932934 AAAAGGTGACAGGCCAGATTTGG - Intergenic
1013435642 6:110103152-110103174 AACAGGGAGCAGGTCAGATTTGG - Intronic
1013455418 6:110325430-110325452 AACAGGCAGCAGGCTGGATTGGG + Intronic
1013663791 6:112326077-112326099 AAGAGGCAACAGGTAAAAATGGG - Intergenic
1013745248 6:113337647-113337669 ACCAGGCAGCAGGCCAGATGTGG + Intergenic
1013801748 6:113953802-113953824 AAGAGGCAATTGGCCAAATTTGG - Intronic
1015015154 6:128404009-128404031 AACAGGCCACAGTCTGAATTTGG + Intronic
1015170049 6:130242365-130242387 AACAGGCAGTAGGCCAGATTTGG + Intronic
1015283521 6:131459201-131459223 AACAGGCAGCAGACCAGATTTGG + Intergenic
1015552859 6:134430373-134430395 AACAGGAAACTGGCACAATTGGG + Intergenic
1015650135 6:135447835-135447857 AACAGGTAGTAGGCCAGATTTGG - Intronic
1015726799 6:136307427-136307449 AACAGGCTGCAGGCTAAATTTGG - Intergenic
1015988231 6:138908032-138908054 AACAGGCCATAGGCTGAATTTGG + Intronic
1016238546 6:141898708-141898730 AAGAGGCAATGGGCTAAATTTGG + Intergenic
1016971274 6:149766529-149766551 TACAGGCCACAGACAAAATTTGG + Intronic
1017229035 6:152052403-152052425 TATAGGCGACAGGACAAATTTGG + Intronic
1017265932 6:152446275-152446297 AACAGGCAACTGGCTAAATGTGG + Intronic
1017631756 6:156402774-156402796 AACAGGCAGAGGGCCAGATTTGG - Intergenic
1018044895 6:159957118-159957140 AACAGGCAGCTGGCCAGATTTGG - Intergenic
1020352257 7:7233726-7233748 AACAGGTAGCAGGCCAGGTTTGG + Intronic
1020778929 7:12494063-12494085 AAAAGGCAACAGGCTAAATAAGG + Intergenic
1020884142 7:13801828-13801850 AACAGGCAGTTGGCCACATTTGG - Intergenic
1020912984 7:14156610-14156632 AACAGGCAGCTGGTCAGATTTGG + Intronic
1020925768 7:14322131-14322153 AACAGGCAGCAGGCCAGATCTGG - Intronic
1021548551 7:21844079-21844101 AAGAGGTGGCAGGCCAAATTAGG - Intronic
1021664643 7:22963747-22963769 AACAGGCATCAGGCCAGACTGGG + Intronic
1021883776 7:25118638-25118660 AACAGGCATCTGGTCAGATTGGG + Intergenic
1022054161 7:26711961-26711983 AACTGGCAACTGACCAAATTAGG + Intronic
1023242800 7:38166510-38166532 AACATGCAACAGAACAAAGTTGG + Intergenic
1023291946 7:38678084-38678106 AACTGTCCACAGGCCAAAATTGG + Intergenic
1023356559 7:39372833-39372855 AACAGGCTATGGGCCAGATTCGG + Intronic
1023385252 7:39650263-39650285 AACAGGCAGCAGGCTGAATTTGG - Intronic
1023532046 7:41168074-41168096 AACAGGCATCAGGCTGGATTTGG - Intergenic
1023678163 7:42652559-42652581 AAAAGGCAATAGGCCAGGTTTGG - Intergenic
1024782975 7:52873909-52873931 AACAGGCTACAGGCCCCTTTGGG + Intergenic
1025122376 7:56316078-56316100 AACAGGAGACAGACCAGATTTGG - Intergenic
1025845571 7:65193500-65193522 AGCAGGCAACAGGCCAGCTTTGG - Intergenic
1025895790 7:65699213-65699235 AGCAGGCAACAGGCCAGCTTTGG - Intergenic
1026197128 7:68182839-68182861 AAAAGTCAAGAAGCCAAATTTGG - Intergenic
1026291053 7:69006515-69006537 AACGGGCATCAGGCCAGATTTGG - Intergenic
1026641786 7:72132835-72132857 AACAGGCTACAGACCGAAATTGG - Intronic
1027329523 7:77077267-77077289 AACAGGCCCCTGGCCAGATTTGG - Intergenic
1027489979 7:78811710-78811732 CACAGGCCATGGGCCAAATTTGG - Intronic
1027680622 7:81216267-81216289 AACAGGACACAGGCCAAATTTGG - Intergenic
1027928960 7:84506499-84506521 AATAGGCAGTAGGGCAAATTTGG + Intergenic
1028194117 7:87885510-87885532 AAAAGGCAACAGACTAGATTTGG - Intronic
1028340401 7:89712380-89712402 AATAGGCAGCAGGCTAGATTTGG + Intergenic
1028357349 7:89925403-89925425 AACAGACAGCAGGCTGAATTTGG - Intergenic
1028703446 7:93810769-93810791 AACAGTGTACAGGCCAAATATGG - Intronic
1028713255 7:93935299-93935321 AACAAGCAGCAGGCTGAATTTGG + Intergenic
1028932920 7:96433747-96433769 AACAAGCAGTGGGCCAAATTTGG + Intergenic
1029011274 7:97264272-97264294 AACAGGCAGTGGGCCAGATTTGG - Intergenic
1029786239 7:102794094-102794116 AACAGGCCCCTGGCCAGATTTGG + Intronic
1030714477 7:112791614-112791636 AACAGGCTACAGAACAGATTGGG - Intergenic
1030797740 7:113809684-113809706 AACAGGCAACGGGCCAGATGGGG - Intergenic
1031189684 7:118531779-118531801 AACAGGCAGAAGGCTAGATTTGG + Intergenic
1031264088 7:119561706-119561728 AACACACAAAAGGCCAAAATTGG - Intergenic
1031463490 7:122080289-122080311 AACAGACAATGAGCCAAATTTGG - Intronic
1032214917 7:129950526-129950548 AAAAGGCATCAGGTCAAGTTAGG + Intronic
1032426668 7:131828135-131828157 AAAAGGCACCAGGCAGAATTTGG - Intergenic
1032865763 7:135922476-135922498 AACAGGCAATGGGCCAGATTCGG + Intergenic
1032906243 7:136370504-136370526 AATAGGCAACAGGCAGCATTTGG - Intergenic
1033205856 7:139421666-139421688 TACAGGCTACCGGCCAGATTTGG - Intronic
1034359278 7:150479950-150479972 AAGAGGGAAGAAGCCAAATTGGG + Intergenic
1034507917 7:151509679-151509701 AACAGGCTGTAGGCCAAATTTGG - Intronic
1034759688 7:153659536-153659558 AGCAGGCGACAGCCCACATTTGG - Intergenic
1036163267 8:6407810-6407832 AACAGGCAGCAGGCTAGATATGG - Intronic
1036214575 8:6868358-6868380 AACAGGCAGCAAGCCAGATTTGG - Intergenic
1036738335 8:11339474-11339496 AACAGGCAGCGGGCCAGATTTGG - Intergenic
1037352081 8:17971214-17971236 AACAGGCAGCAGGCTGAATTTGG + Intronic
1037622322 8:20575670-20575692 AACAGGCAGTAGGCCAGAGTTGG + Intergenic
1037698676 8:21251563-21251585 AATAGGCAAGAGGGCAAAGTGGG + Intergenic
1038536601 8:28358054-28358076 AACAAGCAGCAGGCTACATTGGG - Intronic
1039080329 8:33727846-33727868 AACAGGCACCAAGCCACACTTGG - Intergenic
1039104068 8:33971216-33971238 AATAGGCTGCAGGCCAGATTTGG - Intergenic
1040794389 8:51273177-51273199 AACAGGAAAGAGCCGAAATTGGG + Intergenic
1041041599 8:53851859-53851881 ACCAGGCAACAGGACTCATTTGG + Exonic
1041064725 8:54071334-54071356 AACATACAACACTCCAAATTAGG - Intronic
1041813204 8:61935792-61935814 AACAGGCAGAAGGAAAAATTAGG + Intergenic
1042330909 8:67579677-67579699 AACAGGCAGCAGGCCAGATATGG - Intronic
1042521826 8:69720964-69720986 AACAGGAAGCAGGCTAACTTTGG + Intronic
1043222248 8:77681668-77681690 TTCAGGTAACATGCCAAATTTGG + Intergenic
1043326311 8:79056175-79056197 AATAGGCAGCAGGCTAGATTTGG + Intergenic
1044288351 8:90437540-90437562 AACAATCAACAAGGCAAATTTGG + Intergenic
1044313240 8:90719529-90719551 AACAGGTAGCAGGCCAGATTTGG + Intronic
1044400076 8:91760115-91760137 AACAGCCAAGAGGCTAAATGTGG - Intergenic
1044548961 8:93490977-93490999 AACAAGCAAGGGGCTAAATTTGG + Intergenic
1044619701 8:94176801-94176823 AACTCACAAAAGGCCAAATTGGG + Intronic
1045032675 8:98152660-98152682 AACAGACAGCAGGCCACATTTGG + Intronic
1045181521 8:99788788-99788810 AATAGGCTACATGCCAAATTTGG + Intronic
1045952988 8:107872863-107872885 AACATGCACCAGGGCATATTGGG - Intergenic
1046128471 8:109940096-109940118 AACAGTCTACAGGGCAAACTAGG - Intergenic
1046290461 8:112153401-112153423 AACTGACAACATGCCAAATGAGG + Intergenic
1046358804 8:113123397-113123419 AATAGGCAATAGACCAGATTTGG - Intronic
1046364305 8:113205969-113205991 AAAGGGCATCAGGCCATATTTGG - Intronic
1046716818 8:117577057-117577079 AGCAGGCAATAGGCCAAAGCTGG + Intergenic
1046753703 8:117951755-117951777 AACAGGTGGCAGGCCAGATTTGG - Intronic
1046885945 8:119367274-119367296 AACAGTCAGCAGACCAAATTTGG + Intergenic
1047026790 8:120833109-120833131 AACAGGTAGCAGGTCAGATTTGG - Intergenic
1047796472 8:128261180-128261202 AACAGGCAATGGGCAATATTTGG + Intergenic
1047886115 8:129251739-129251761 ACCAGGCAGCAGGCTAGATTTGG - Intergenic
1048143508 8:131819068-131819090 AACAAGTGACAAGCCAAATTTGG + Intergenic
1050015682 9:1231330-1231352 AACAGGCAACAGATGACATTTGG + Intergenic
1050243524 9:3662480-3662502 AAAAGTCAACAAGCCATATTGGG - Intergenic
1050378162 9:4994695-4994717 AACAGGCAGCTGGCTAAATTTGG + Intronic
1050440534 9:5657767-5657789 AACAGGCACCAGGGCATATTTGG - Intronic
1050622072 9:7464535-7464557 AACAGGCAGCAAGCTAGATTTGG + Intergenic
1050859522 9:10409030-10409052 AACAGGCTGTAGGCCAGATTTGG - Intronic
1051066560 9:13111141-13111163 AACAGGCAGTGGGCCAAATTTGG - Intronic
1051195625 9:14560590-14560612 AATAGGCCACTGGCCAAACTTGG + Intergenic
1051677056 9:19569261-19569283 AACAGGCTGCAGGCCAGATTTGG + Intronic
1051731646 9:20149752-20149774 AACAGGCAGCAGGCCACATTTGG + Intergenic
1051845466 9:21447108-21447130 GACAGGCAGCAAGCCAAGTTGGG - Intergenic
1052238104 9:26237354-26237376 AACAGGCAGCAGGCCAGAGCTGG + Intergenic
1052841904 9:33298829-33298851 AGAAGGCAACAGGACAAGTTAGG + Intronic
1053362318 9:37497503-37497525 CACAGGCAGCAGGCCAGACTTGG - Intronic
1055311643 9:74988803-74988825 AATAGGCTACAGGCCAAATTGGG + Intronic
1055590483 9:77807961-77807983 AATAGGCAGCAGGCCAAATTTGG + Intronic
1055862998 9:80776183-80776205 AACAGCCCACAGGCCAAATCTGG - Intergenic
1055949908 9:81720881-81720903 AACAGGCTTCAGGCCAAAGCTGG - Intergenic
1056285919 9:85088129-85088151 AACAGGCTGCAGGCCAGCTTTGG + Intergenic
1056879466 9:90377406-90377428 AACAGGCTGTAGGCCAATTTTGG - Intergenic
1057198825 9:93129780-93129802 CCCAGGCAGCAGGCCACATTGGG + Intronic
1057506931 9:95642435-95642457 AACAGGCAATGGGCCAGAATTGG + Intergenic
1057552538 9:96062621-96062643 AACAGGCAGTGGGCCAGATTTGG + Intergenic
1058127952 9:101217673-101217695 AACAGGCAATAGACCAGGTTTGG + Intronic
1058278647 9:103082387-103082409 AAAAGGCAACAGGAATAATTTGG + Intergenic
1058468417 9:105251956-105251978 AACAGGTAGCAGGTCAGATTTGG - Intronic
1058646776 9:107138403-107138425 AACAGGCAGTGGGCCAAATTTGG - Intergenic
1059173717 9:112150217-112150239 AACAGGCAGCAGGTCGAACTTGG + Intronic
1059319600 9:113458342-113458364 AACAGGCAGCCAGCCAGATTTGG + Intronic
1059946867 9:119418139-119418161 AACAGGCAATAGGCCAGACTTGG + Intergenic
1060223774 9:121778760-121778782 AACAGGCAATGGTCCAGATTTGG + Intronic
1060302117 9:122380523-122380545 TACAGCCTGCAGGCCAAATTCGG + Intronic
1060382712 9:123191738-123191760 AACAGGCAATGGGCCAAATTTGG + Intronic
1060416378 9:123433759-123433781 AGCAAGCAACAGGATAAATTAGG - Intronic
1060421905 9:123475307-123475329 ACCACGCAACAGGCCAGATGCGG - Intronic
1060774352 9:126360438-126360460 AACAGGCTACAGGCTGGATTTGG + Intronic
1061538537 9:131264698-131264720 AAAAGGCTTCAGGTCAAATTAGG - Intronic
1061760715 9:132849314-132849336 AGCAGGCAGCAGGCCAGATTTGG - Intronic
1062059125 9:134485490-134485512 AGCAGGCAGCAGGCCACATGTGG - Intergenic
1186109053 X:6236726-6236748 GACAGGCAACAGGTAAATTTAGG + Intergenic
1186157654 X:6742303-6742325 AACAGGCAGTGGGCCAGATTTGG - Intergenic
1186335012 X:8577066-8577088 ACCAGGTTGCAGGCCAAATTTGG + Intronic
1186370592 X:8942921-8942943 AACATGTAGCAGGCCAAATTTGG + Intergenic
1186544672 X:10436231-10436253 TACAGGTAACAAGCCAGATTTGG - Intergenic
1186592562 X:10946669-10946691 AGCAGGCAATGGGCCAGATTTGG + Intergenic
1186701949 X:12099950-12099972 AACAAGCCACAGGCCAGATTTGG - Intergenic
1186706342 X:12143264-12143286 AACAGTCAGCAAGCCAGATTTGG - Intronic
1186708674 X:12169926-12169948 AACAGGCAGTGGGCCAGATTTGG + Intronic
1186709143 X:12174342-12174364 AACAGGTGATAGGCCAGATTTGG + Intronic
1186748105 X:12591514-12591536 AACAGGCAGAGGGCCAGATTTGG - Intronic
1186753162 X:12642564-12642586 AACAGGTAGTAGGCCAGATTTGG - Intronic
1186842521 X:13498373-13498395 AACAGGCAGTATGCCAGATTTGG - Intergenic
1186846153 X:13533075-13533097 AACAGGAAGCAGGACACATTTGG - Intergenic
1186872040 X:13782812-13782834 AACAGGTAGTAGGTCAAATTTGG + Intronic
1186896322 X:14007962-14007984 AACAGACTGCAGGCCAGATTTGG - Intergenic
1186927715 X:14353343-14353365 AACAAGCAGTAGGCCAGATTTGG - Intergenic
1187019492 X:15365482-15365504 GGCAGGCAGCAGGCTAAATTAGG - Intronic
1187027885 X:15455022-15455044 AAAAGGAATCAGGACAAATTAGG - Intronic
1187052947 X:15712933-15712955 AACAGGTAACAGGCTGGATTTGG + Intronic
1187080546 X:15982079-15982101 AACAGGCTAAGGGCCAGATTTGG - Intergenic
1187708279 X:22028666-22028688 AACAGGCAGTGGGCCAAATTTGG + Intergenic
1187721844 X:22159282-22159304 AACAGGCAGAATGCCAAATATGG - Intronic
1187724498 X:22188482-22188504 AACAGGCAGCAGGTGAGATTTGG - Intronic
1187729324 X:22236574-22236596 AACAGGCAGCAGGCCATATTTGG - Intronic
1187744215 X:22390476-22390498 AACAGGTAGTAGCCCAAATTTGG - Intergenic
1188644208 X:32544078-32544100 AACTGGCAGCATGCTAAATTTGG + Intronic
1188748407 X:33875010-33875032 AACTGGCAAAAGGCAGAATTAGG - Intergenic
1189339717 X:40195564-40195586 AACAGGCAGCTGGCCAGATCTGG + Intergenic
1190794506 X:53728502-53728524 AACAGGCAGCAGGCTGGATTTGG - Intergenic
1192182562 X:68925369-68925391 AACAGGCAGTGGGCCAGATTTGG - Intergenic
1192342662 X:70277187-70277209 AACAGGCATCAGGCCAGATTTGG + Intronic
1192710938 X:73587024-73587046 AACAGGCAGCAAGCCAGATCTGG + Intronic
1192859337 X:75048981-75049003 ATGAGGAAACAGGCCAAGTTGGG - Intergenic
1193743088 X:85242404-85242426 AACAGGCAGCAGTCCAGATTTGG - Intergenic
1194842345 X:98758932-98758954 AACAAGCAGTAAGCCAAATTTGG - Intergenic
1194866335 X:99073150-99073172 AACAAGCTACAGGCTGAATTTGG + Intergenic
1195425843 X:104729429-104729451 AAAAGGCAGCAGGCCCTATTTGG - Intronic
1195590158 X:106615326-106615348 AACAAGCAACAGGCAAGATTTGG + Intronic
1196098031 X:111820407-111820429 ACCAGGTGACAGTCCAAATTTGG - Intronic
1196101366 X:111850578-111850600 GACAGGCCACATGCAAAATTTGG - Intronic
1196108519 X:111921307-111921329 AACAGTTGACAGGCCAGATTTGG + Intronic
1196855782 X:119982196-119982218 GACAGGCAAGCTGCCAAATTGGG - Intergenic
1196962751 X:121021642-121021664 ATTATGCAACAGGGCAAATTTGG - Intergenic
1197300780 X:124777989-124778011 AACAGTCGATAGGCCAGATTTGG + Intronic
1198064297 X:133081061-133081083 AGGAGGAGACAGGCCAAATTAGG - Intronic
1198532547 X:137560448-137560470 AACAGGCTATGGGCCAGATTTGG + Intergenic
1200300109 X:154965646-154965668 AGCAGGCCACAAGCCAAATTTGG + Intronic
1201469881 Y:14321441-14321463 AACAAGCAGTAGGCCAGATTTGG - Intergenic
1201551204 Y:15218696-15218718 CACAGCCCACAGGCCAAATCTGG + Intergenic
1201751618 Y:17438131-17438153 AACAAACATCAGGGCAAATTGGG + Intergenic
1201788813 Y:17815200-17815222 AAAAAGTAACAGGTCAAATTAGG - Intergenic
1201812740 Y:18090787-18090809 AAAAAGTAACAGGTCAAATTAGG + Intergenic
1202334102 Y:23788544-23788566 AAAAAGTAACAGGTCAAATTAGG - Intergenic
1202350426 Y:23984264-23984286 AAAAAGTAGCAGGCCAAATTAGG - Intergenic
1202520353 Y:25685857-25685879 AAAAAGTAGCAGGCCAAATTAGG + Intergenic
1202536666 Y:25881515-25881537 AAAAAGTAACAGGTCAAATTAGG + Intergenic