ID: 947192319

View in Genome Browser
Species Human (GRCh38)
Location 2:227519948-227519970
Sequence GTCTGTAAACAGATTTGGCT AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 114}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947192319 Original CRISPR GTCTGTAAACAGATTTGGCT AGG Exonic
902927845 1:19708797-19708819 GTCAGTAAAGAGATTCTGCTGGG + Intronic
910638856 1:89439055-89439077 GGCTGTAACCAGATTAGCCTTGG + Intergenic
912590407 1:110813223-110813245 GTCTGTATTCATATTTGTCTTGG - Intergenic
915076590 1:153312914-153312936 TGCTGTAAACAGAGCTGGCTTGG - Intergenic
915553784 1:156650032-156650054 ATCTGTGGACATATTTGGCTGGG + Intronic
916964321 1:169919512-169919534 GTATGTAAAAATATTAGGCTGGG + Intergenic
922661626 1:227435360-227435382 GTTAGTAACCAGAGTTGGCTGGG - Intergenic
923480222 1:234376848-234376870 GGCTGTAAACAGGATTGCCTTGG - Intronic
1067825087 10:49565532-49565554 GTCTGGAAACAGGTCTAGCTTGG - Intergenic
1068003697 10:51367928-51367950 GTTTGTAGACTGGTTTGGCTGGG - Intronic
1068555777 10:58457156-58457178 ATCTGTAAAAAGAGTTGGCCAGG - Intergenic
1075850684 10:125584243-125584265 GTGTGTCAGCAGCTTTGGCTGGG - Intronic
1077063585 11:627946-627968 GTCTGTGAACAGATTTTGAGAGG - Intergenic
1078674171 11:13394218-13394240 GTTTGTAATGAGATTTGGATGGG - Intronic
1080461506 11:32458829-32458851 GCCTGTAATGAGATTGGGCTGGG + Intergenic
1087916225 11:103814663-103814685 CTCTGTAAATAGATTTTTCTAGG + Intergenic
1092448663 12:8581966-8581988 ATCAGTCAACATATTTGGCTTGG + Intergenic
1094133055 12:27095356-27095378 GTTTGGAAGCAAATTTGGCTAGG + Intergenic
1094700880 12:32869698-32869720 TTCTGTAAACAGATTTCTTTTGG - Intronic
1096870610 12:54589953-54589975 ATGTGTAAAAAGATATGGCTGGG - Intergenic
1098857608 12:75670280-75670302 GTCTGCTAACAGACTTGGCCAGG - Intergenic
1103379699 12:120484331-120484353 GTGTGTATACAGATGTGGGTGGG + Intronic
1103516851 12:121513855-121513877 GTCTGCAAATAGATAAGGCTTGG - Intronic
1107215688 13:37915870-37915892 GTCTGTAAACATATTTATATTGG + Intergenic
1107991791 13:45825287-45825309 GATTGTAATGAGATTTGGCTAGG - Intronic
1108994526 13:56710979-56711001 GTATGTAAACACATGTAGCTAGG - Intergenic
1111113930 13:83751080-83751102 GTCAGTAAACAGGTTTGGTGTGG + Intergenic
1112459000 13:99586586-99586608 GTCTGTAATAAGACTTGGGTGGG - Intergenic
1113058280 13:106293178-106293200 GTCTCTAAACTGCTTTGACTGGG + Intergenic
1119601713 14:75981134-75981156 GTGTCTAAACAGGTTTTGCTGGG + Exonic
1121063770 14:90941292-90941314 CTCTGTAGAGAGATTTGGCTGGG + Intronic
1124468347 15:29960996-29961018 GTCTTTAAAAATATTTGTCTTGG + Intronic
1128814313 15:70596107-70596129 GTCTGGAAACATTTTTGGATTGG + Intergenic
1129659370 15:77544408-77544430 GTCTGGTCACAGATTGGGCTCGG + Intergenic
1130007509 15:80114318-80114340 GTATGTAAACAGAATGGGCTTGG - Intronic
1130838926 15:87679275-87679297 TTTTGTAAACTGATTTTGCTTGG - Intergenic
1133551671 16:6861932-6861954 GTCTGCAAACAGAACTGGTTTGG + Intronic
1136156305 16:28384641-28384663 GACTGTAAACAGGAATGGCTGGG + Intronic
1136206781 16:28730646-28730668 GACTGTAAACAGGAATGGCTGGG - Intronic
1136291695 16:29276797-29276819 GTTTTTAAACAGATTGGGGTTGG - Intergenic
1137342362 16:47621127-47621149 ATCTGTAAAATTATTTGGCTGGG + Intronic
1137540510 16:49358550-49358572 GTCTGGAAACATTTTTGGTTTGG - Intergenic
1141057378 16:80831113-80831135 GTTCAAAAACAGATTTGGCTGGG + Intergenic
1142097577 16:88250741-88250763 GTTTTTAAACAGATTGGGGTTGG - Intergenic
1142502394 17:340282-340304 GTCTGGAGACAAATTTGGCAAGG - Intronic
1144127527 17:12217137-12217159 GTTTGGAAACAGATTGGGGTTGG + Intergenic
1147530769 17:41275196-41275218 GTCTTGAAACAGATTTTGGTGGG + Intergenic
1149382834 17:56110950-56110972 GTCTCTAAACAGAGCTGGCTGGG + Intronic
1150867104 17:68863992-68864014 GTATGTAAACAGATCTCACTAGG - Intergenic
1153592154 18:6684940-6684962 TTATGTAAATAGTTTTGGCTTGG + Intergenic
1155097238 18:22569525-22569547 GTGTGTGAAAAGATTTGGCAGGG - Intergenic
1156039886 18:32808904-32808926 GTTTGTGCTCAGATTTGGCTGGG + Intergenic
1159018684 18:63124740-63124762 GTGTGTAACCACATTTGTCTGGG + Exonic
1160553687 18:79712577-79712599 CTCTGTAAACAGACCAGGCTAGG - Intronic
1167877824 19:52428966-52428988 ATCTGTAAACAGATCTTGCTGGG - Intergenic
1168586480 19:57598011-57598033 GTCTATAAGTACATTTGGCTTGG - Intergenic
926732240 2:16044657-16044679 GTCTTTAAACAGATTTTACCTGG - Intergenic
927842103 2:26451509-26451531 GCCTGTAAAAAGAGTTGGCTGGG + Intronic
930445603 2:51467813-51467835 GTCTGGAAACAGATTTTGGATGG + Intergenic
931683056 2:64768619-64768641 TTTTGTAAACAGATTTTTCTGGG + Intergenic
933742785 2:85547901-85547923 TAATGAAAACAGATTTGGCTGGG + Exonic
933791897 2:85889500-85889522 TTATGCAAACATATTTGGCTCGG - Intergenic
934720160 2:96568595-96568617 TTCTGGAAACAGACTGGGCTAGG - Intergenic
940914714 2:159241602-159241624 ATCTTTAAAAAAATTTGGCTTGG - Intronic
941314611 2:163976949-163976971 GGATGTAAACAGCTTTGGGTGGG - Intergenic
944731307 2:202520604-202520626 GTCTGCCAAAAGATGTGGCTGGG - Intronic
947064567 2:226208063-226208085 GTCTGTATACAGATAAGTCTGGG + Intergenic
947192319 2:227519948-227519970 GTCTGTAAACAGATTTGGCTAGG + Exonic
1168961171 20:1871103-1871125 GTCTATGAAAAGATTTGGCAAGG + Intergenic
1169557006 20:6762012-6762034 GTCTGTAATCAGTTTTGACAGGG - Intergenic
1173550293 20:43928325-43928347 ATCTGTAGACAGATTTGGAAAGG - Intronic
1173669828 20:44790992-44791014 TTCTGTCAACAGACTTGGCAAGG - Intronic
1175910729 20:62404381-62404403 CTCTGGGAACAGACTTGGCTTGG - Intronic
1182033474 22:27179266-27179288 ATCAGTAAACAGAATTGGCCTGG + Intergenic
1182364805 22:29771358-29771380 GTCTCTAAAAATTTTTGGCTGGG + Intergenic
1182703004 22:32255598-32255620 GTCTTTAAAGAGATTTGCCCAGG + Intergenic
1184260436 22:43312402-43312424 GTCTGTCAACAGATTTGTGTAGG + Intronic
1184510643 22:44931271-44931293 CTCAGTAAACAGAATTGCCTCGG - Intronic
1184848543 22:47104009-47104031 GTCTGTAAAGAATCTTGGCTGGG + Intronic
950982629 3:17325116-17325138 TTGTGTAAACATATTTGTCTTGG - Intronic
952224373 3:31359400-31359422 ATGTTTAAACAGATTCGGCTTGG + Intergenic
953747100 3:45583421-45583443 TTCTGGAAACAGATTTGGAGGGG + Intronic
955503881 3:59611952-59611974 GTCTGGAAACAGAAATGCCTCGG - Intergenic
957799374 3:85055361-85055383 GTCTGAAAACAGATTTTTCATGG - Intronic
959673265 3:109003742-109003764 GGTTGTAAACAGATTCAGCTTGG + Intronic
960417262 3:117399626-117399648 GTGTGTAATCAGAGATGGCTTGG - Intergenic
972950484 4:44316516-44316538 GTGAGAAAACACATTTGGCTCGG - Intronic
975323528 4:73035326-73035348 GTATGTAAACATATTTGGCTAGG + Intergenic
977529379 4:98182219-98182241 GTCTGGTAACAGATTTTGCAAGG - Intergenic
980132760 4:128831971-128831993 GTCTGTAACCAGATCTTACTGGG + Intronic
980394788 4:132197662-132197684 GTCAGTAAAGACATTTGGCATGG - Intergenic
982504704 4:156202629-156202651 GTTTGCAAAAAGATGTGGCTAGG - Intergenic
983162078 4:164428667-164428689 GTGTGTAAACATTTTTGCCTTGG - Intergenic
983576792 4:169270157-169270179 GGGAGTAAAAAGATTTGGCTGGG + Intronic
983955609 4:173695522-173695544 GTTTTTAAAAATATTTGGCTGGG - Intergenic
992171626 5:74107559-74107581 GTCTGGAGACAGACTTGGTTTGG - Intergenic
994252069 5:97547610-97547632 GACTGTAAACAGACATGGCCTGG - Intergenic
994505180 5:100634067-100634089 GTCTTTGAACAGAATTGGCTTGG + Intergenic
995038023 5:107557183-107557205 GGCTGTAAACATATTTGCCTTGG + Intronic
1000629584 5:163577081-163577103 CCCTTTAAACAGCTTTGGCTTGG + Intergenic
1002518316 5:179775350-179775372 GTTTTTAAACAGATTAGGGTAGG + Exonic
1007106860 6:39289356-39289378 GTCTGTCAACAAATCTGGATAGG - Intergenic
1013941464 6:115667984-115668006 CCCTGTGAACAGACTTGGCTCGG - Intergenic
1014249771 6:119103311-119103333 GTCAGTAAATAGATTTGGGGGGG - Intronic
1016336696 6:143013245-143013267 GGATGTAAACAGATTTACCTTGG - Intergenic
1017824170 6:158069433-158069455 TTCTGCAAACAGAATAGGCTTGG + Intronic
1023166884 7:37351721-37351743 GGCAGTAAACAGATATGGTTAGG - Intronic
1026810925 7:73464028-73464050 GTCTGAATACAGATGTGTCTAGG - Intronic
1029928775 7:104348089-104348111 TTAAGAAAACAGATTTGGCTGGG + Intronic
1035893963 8:3376335-3376357 GTCTGAAAACATATTTGAATTGG + Intronic
1038763173 8:30403629-30403651 GTGTATACACAGATTTAGCTAGG - Intronic
1039360492 8:36871715-36871737 GTATGGAAATTGATTTGGCTGGG + Intronic
1050910183 9:11058307-11058329 TTCTGTATACAGTTTTGGTTTGG + Intergenic
1052525030 9:29606361-29606383 ATCTGTAAACTGATTTGGGTAGG - Intergenic
1058761280 9:108135683-108135705 TTCTGTAATCAGCTTTTGCTTGG - Intergenic
1059531745 9:115041722-115041744 GTCTTTAGGCAGATTTGACTGGG + Intronic
1060567088 9:124602580-124602602 GGCTGAAACCAGAGTTGGCTTGG - Intronic
1188346792 X:29077216-29077238 GGGAGTACACAGATTTGGCTGGG + Intronic
1188640546 X:32496958-32496980 GTCTGTATACAAATGTGGCATGG - Intronic
1189015755 X:37094868-37094890 GTGTATACACAGATTTAGCTAGG - Intergenic
1192462169 X:71326065-71326087 GTCTGTAAATAAATAGGGCTGGG + Intergenic
1193107260 X:77690234-77690256 GTCTTTAAAAAGAATTAGCTGGG - Intronic
1193805796 X:85992935-85992957 GTCTATAAACGGATTTGAATGGG - Intronic
1194306066 X:92250226-92250248 GTCTTTAAAAATATTTGGATAGG + Intronic
1201521365 Y:14877638-14877660 GTCTGAAAACCGATTTCACTTGG + Intergenic