ID: 947198892

View in Genome Browser
Species Human (GRCh38)
Location 2:227597228-227597250
Sequence TGTGATCTAAGGACCTCTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947198886_947198892 26 Left 947198886 2:227597179-227597201 CCTCAAGGACCAAAATCTTTCCA No data
Right 947198892 2:227597228-227597250 TGTGATCTAAGGACCTCTGGAGG No data
947198889_947198892 6 Left 947198889 2:227597199-227597221 CCAAGTCTCTGCTCTGGCAGTCT No data
Right 947198892 2:227597228-227597250 TGTGATCTAAGGACCTCTGGAGG No data
947198887_947198892 17 Left 947198887 2:227597188-227597210 CCAAAATCTTTCCAAGTCTCTGC No data
Right 947198892 2:227597228-227597250 TGTGATCTAAGGACCTCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947198892 Original CRISPR TGTGATCTAAGGACCTCTGG AGG Intergenic
No off target data available for this crispr