ID: 947202266

View in Genome Browser
Species Human (GRCh38)
Location 2:227624764-227624786
Sequence ACTATAGGGTTCACGCAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 50
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 47}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947202266_947202270 -5 Left 947202266 2:227624764-227624786 CCAGGCTGCGTGAACCCTATAGT 0: 1
1: 0
2: 0
3: 2
4: 47
Right 947202270 2:227624782-227624804 ATAGTGAATTGTGCGTGTGAGGG 0: 1
1: 0
2: 33
3: 280
4: 803
947202266_947202269 -6 Left 947202266 2:227624764-227624786 CCAGGCTGCGTGAACCCTATAGT 0: 1
1: 0
2: 0
3: 2
4: 47
Right 947202269 2:227624781-227624803 TATAGTGAATTGTGCGTGTGAGG 0: 1
1: 0
2: 30
3: 296
4: 812
947202266_947202271 2 Left 947202266 2:227624764-227624786 CCAGGCTGCGTGAACCCTATAGT 0: 1
1: 0
2: 0
3: 2
4: 47
Right 947202271 2:227624789-227624811 ATTGTGCGTGTGAGGGATCTAGG 0: 1
1: 26
2: 286
3: 787
4: 1321

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947202266 Original CRISPR ACTATAGGGTTCACGCAGCC TGG (reversed) Intronic