ID: 947202266

View in Genome Browser
Species Human (GRCh38)
Location 2:227624764-227624786
Sequence ACTATAGGGTTCACGCAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 50
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 47}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947202266_947202269 -6 Left 947202266 2:227624764-227624786 CCAGGCTGCGTGAACCCTATAGT 0: 1
1: 0
2: 0
3: 2
4: 47
Right 947202269 2:227624781-227624803 TATAGTGAATTGTGCGTGTGAGG 0: 1
1: 0
2: 30
3: 296
4: 812
947202266_947202271 2 Left 947202266 2:227624764-227624786 CCAGGCTGCGTGAACCCTATAGT 0: 1
1: 0
2: 0
3: 2
4: 47
Right 947202271 2:227624789-227624811 ATTGTGCGTGTGAGGGATCTAGG 0: 1
1: 26
2: 286
3: 787
4: 1321
947202266_947202270 -5 Left 947202266 2:227624764-227624786 CCAGGCTGCGTGAACCCTATAGT 0: 1
1: 0
2: 0
3: 2
4: 47
Right 947202270 2:227624782-227624804 ATAGTGAATTGTGCGTGTGAGGG 0: 1
1: 0
2: 33
3: 280
4: 803

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947202266 Original CRISPR ACTATAGGGTTCACGCAGCC TGG (reversed) Intronic
900415090 1:2531111-2531133 ACTACAGTGTCCACGCAGCTCGG + Intergenic
901739735 1:11334420-11334442 CCTGTAGGGTCCACCCAGCCGGG - Intergenic
903085001 1:20848517-20848539 ACTATAGGGTTCACAAGGTCAGG + Intronic
913345640 1:117806900-117806922 ACTATAGTGTTTTGGCAGCCAGG + Intergenic
1069271125 10:66529080-66529102 ACTTTAGGCTCCACACAGCCTGG + Intronic
1069593541 10:69656300-69656322 ACCATCGGGTTCACGAGGCCAGG - Intergenic
1073488306 10:103835782-103835804 ACTCTATAGTTCATGCAGCCAGG + Intronic
1077113146 11:870659-870681 AATACAGGGTTCACACGGCCTGG - Intronic
1078084521 11:8225683-8225705 ACTAAAGGCTTCACCCACCCTGG - Intronic
1091565795 12:1647017-1647039 AGTATAACGTCCACGCAGCCTGG - Exonic
1094493838 12:30977337-30977359 ACTCTAGGGCTCACCCAGCAGGG - Intronic
1098074326 12:66711840-66711862 CCCATAGTGTTCACGCAGCTTGG - Intronic
1098162601 12:67659742-67659764 ACTGTAAGGTTCTCTCAGCCTGG + Exonic
1108461325 13:50670378-50670400 ACAATAGGGTTCACGCTCCTAGG + Intronic
1111300973 13:86349915-86349937 ACTACAGGGTTCACTCTGACTGG + Intergenic
1123965831 15:25456391-25456413 ACTCTAGGGTTCAGGCAAGCTGG + Intergenic
1124995027 15:34715352-34715374 GCTAGAGGGATCAAGCAGCCTGG - Intergenic
1125932939 15:43612940-43612962 ACTATAGGGTTCTTGCAGGGAGG + Intronic
1125946038 15:43712402-43712424 ACTATAGGGTTCTTGCAGGGAGG + Intergenic
1128491020 15:68144532-68144554 AGGAAAGGGTTCAGGCAGCCAGG + Intronic
1140584499 16:76273913-76273935 ACTATAGGTTACACCCTGCCTGG - Intergenic
1149145453 17:53486473-53486495 ACTATAGTGATCACACAGTCAGG + Intergenic
1149326065 17:55530913-55530935 ACTATTAGATTCAGGCAGCCAGG + Intergenic
1151974074 17:77474613-77474635 AGTATGGGGTTCCTGCAGCCAGG - Intronic
1155586600 18:27373371-27373393 ACTGTAGGGTGAACTCAGCCCGG + Intergenic
1161912714 19:7206542-7206564 ACAATAGGGTTCACGCTCCTAGG - Intronic
1168009888 19:53521567-53521589 TCTGTAGGGGTGACGCAGCCGGG + Exonic
931435296 2:62240684-62240706 GCTTTAGGGTCCACACAGCCTGG + Intergenic
935066891 2:99656895-99656917 TCTATAGGGGTCAGGCAGTCAGG + Intronic
946185752 2:217979597-217979619 CCTATAAGGTTCCCGAAGCCTGG + Intronic
947202266 2:227624764-227624786 ACTATAGGGTTCACGCAGCCTGG - Intronic
948084136 2:235232383-235232405 TCTACAGGGTGCAGGCAGCCGGG + Intergenic
1177149121 21:17437034-17437056 ACTATTGCTTTCAGGCAGCCTGG - Intergenic
1183715967 22:39533855-39533877 ACCACTGGGTTCACTCAGCCGGG + Intergenic
952295685 3:32059940-32059962 AATATAGGGTTCGAGAAGCCAGG + Intronic
966461118 3:180177475-180177497 ACTGTAAGGTTCATGAAGCCAGG - Intergenic
999154891 5:149451039-149451061 ACTAAAGAGGTCACGCAGCCCGG + Intergenic
1003960026 6:11200169-11200191 ACTATAGGGCTCACCAAGGCAGG + Intronic
1021986334 7:26101587-26101609 ACTGCAGGGGTCACGCAGACTGG - Intergenic
1022557762 7:31316878-31316900 AGTAGAGGGTTCAGGCAGCTTGG + Intergenic
1030465936 7:109903876-109903898 GCTAGAGGTTTCACACAGCCAGG - Intergenic
1035332327 7:158104491-158104513 ACTATAGGGCTCACCTAGGCAGG + Intronic
1037333216 8:17765127-17765149 ACAATAGGGTTCACACTCCCAGG + Intronic
1037782703 8:21881666-21881688 GCTATAGGGTTCACCCTGTCCGG + Intergenic
1039997494 8:42546516-42546538 ATTATACTGTTCACGAAGCCTGG + Exonic
1060419893 9:123460886-123460908 ACTATATGCTTCACGCAGGCCGG + Intronic
1188127792 X:26391592-26391614 AATATAGGCTTCACGGAGGCTGG + Intergenic
1188890811 X:35609789-35609811 ACTAAATGTTTCACGCATCCAGG - Intergenic
1201261941 Y:12167319-12167341 ATTATAGGGTTCTCTCAGCTGGG - Intergenic
1201310440 Y:12594338-12594360 TCTATAGGGTTACTGCAGCCAGG + Intergenic