ID: 947202270

View in Genome Browser
Species Human (GRCh38)
Location 2:227624782-227624804
Sequence ATAGTGAATTGTGCGTGTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1117
Summary {0: 1, 1: 0, 2: 33, 3: 280, 4: 803}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947202266_947202270 -5 Left 947202266 2:227624764-227624786 CCAGGCTGCGTGAACCCTATAGT 0: 1
1: 0
2: 0
3: 2
4: 47
Right 947202270 2:227624782-227624804 ATAGTGAATTGTGCGTGTGAGGG 0: 1
1: 0
2: 33
3: 280
4: 803
947202265_947202270 -4 Left 947202265 2:227624763-227624785 CCCAGGCTGCGTGAACCCTATAG 0: 1
1: 0
2: 0
3: 1
4: 58
Right 947202270 2:227624782-227624804 ATAGTGAATTGTGCGTGTGAGGG 0: 1
1: 0
2: 33
3: 280
4: 803

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947202270 Original CRISPR ATAGTGAATTGTGCGTGTGA GGG Intronic