ID: 947202271

View in Genome Browser
Species Human (GRCh38)
Location 2:227624789-227624811
Sequence ATTGTGCGTGTGAGGGATCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2421
Summary {0: 1, 1: 26, 2: 286, 3: 787, 4: 1321}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947202266_947202271 2 Left 947202266 2:227624764-227624786 CCAGGCTGCGTGAACCCTATAGT 0: 1
1: 0
2: 0
3: 2
4: 47
Right 947202271 2:227624789-227624811 ATTGTGCGTGTGAGGGATCTAGG 0: 1
1: 26
2: 286
3: 787
4: 1321
947202265_947202271 3 Left 947202265 2:227624763-227624785 CCCAGGCTGCGTGAACCCTATAG 0: 1
1: 0
2: 0
3: 1
4: 58
Right 947202271 2:227624789-227624811 ATTGTGCGTGTGAGGGATCTAGG 0: 1
1: 26
2: 286
3: 787
4: 1321

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947202271 Original CRISPR ATTGTGCGTGTGAGGGATCT AGG Intronic